Anti flag m2 peroxidase hrp antibody

The scFv genes from selection round two and three were sub-cloned from the phage display vector using NcoI and NotI restriction endonuclease sites into the pSANG10-3F vector for expression of soluble scFvs (30 (link)) and transformed into E. coli strain BL21(DE3) (New England Biolabs). For each selection round, 267 individual scFv clones were picked, expressed in 96-well format, and scFv-containing supernatants were tested for binding to MaxiSorp plates coated with 5 µg/ml α-LTX, as previously described (29 (link)). For binding detection, a monoclonal scFv ELISA was performed, using a 1:20,000 dilution of ANTI-FLAG M2-Peroxidase (HRP) antibody (Sigma-Aldrich, #A8592) in 3% (w/v) skimmed milk in PBS and o-phenylenediamine dihydrochloride (OPD) solution (Sigma-Aldrich, #SLBP6518V) according to the manufacturer’s protocol. Upon initial screening, 39 scFvs were selected and sequenced (Eurofins Genomics sequencing service) using the S10b primer (GGCTTTGTTAGCAGCCGGATCTCA). The antibody framework and CDR regions were annotated and analyzed to identify unique clones.

Samples electrophoresed on an SDS-PAGE gel were transferred to a polyvinylidene difluoride (PVDF) membrane pre-blocked with 1% serum in PBS-T (PBS with 0.1% Tween 20, pH 7.4), and subsequently probed with monoclonal anti-FLAG M2-peroxidase (HRP) antibody produced in mouse (Sigma) in PBS-T. Western blots were imaged by SuperSignal^TM West Pico Chemiluminescent Substrate (Thermo Scientific) and exposed to film.

To assess the total amount of stalled nascent chains, RNC samples purified from sucrose cushions, as described above, were treated with 100 μg mL⁻¹ DNase-free RNase A (ThermoFisher, EN0531) at 37 °C for 50 min followed by western blot with monoclonal Anti-FLAG M2-Peroxidase (HRP) antibody (Sigma, A8592) for the CDH1-derived nascent chains (1:10,000 dilution), as well as with an anti-RPLP0 antibody (Bethyl Laboratories, A302-882A) used as a loading control (1:8000 dilution). In order to visualize tRNA-bound stalled nascent chains, the RNC samples from the above sucrose cushions were heated at 55 °C for 5 min in the presence of 1× Laemmli Sample buffer (Bio-Rad, 1610737). Subsequently, these samples were resolved on NuPAGE 4–12% Bis–Tris protein gels (ThermoFisher Scientific, NP0323PK2) prior to western blot analysis^{50 (link)}.

AD293 cells were transfected with 100 ng pcDNA3-GPR3-3× FLAG per well of 24-well plate by PEI at the ratio of 5:1 over DNA amount. Two days after transfection, cells were lysed by cell lysis reagent (Sigma), and proteins in cell lysates were separated in 10% Bis-Tris gels at 170 V for 1 h and then transferred onto polyvinylidene difluoride (PVDF) membranes at 100 V for 1.5 h. The membranes were blocked with 10% milk in TBS-T (20 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.1% Tween-20) at RT for 30 min. One of the membranes was incubated at RT for 2 h with monoclonal anti-FLAG M2-peroxidase (HRP) antibody (1:5000, Sigma) in TBS-T. The other one was incubated with β-actin mouse mAb (1:10,000, ABclonal) in TBS-T at RT for 2 h. After being washed with TBS-T, the membrane was incubated for 30 min with HRP goat anti-mouse IgG (1:5000, ABclonal) in TBS-T. After treatment with chemiluminescent substrate (Thermo Fisher Scientific), protein bands were detected by iBright CL1000 imaging system (Thermo Fisher Scientific).

The binding of these two Fabs to different RBDs from SARS-CoV-2, SARS-CoV, and MERS-CoV was evaluated by an ELISA. RBD-Fc fusions from SARS-CoV-2, SARS-CoV, and MERS-CoV were coated as described above. Irrelevant Fc protein also coated a negative control. Threefold serially diluted Fabs from 1000 nM were added and incubated at 37 °C for 90 min. A mouse monoclonal ANTI-FLAG^® M2-Peroxidase (HRP) antibody (Sigma-Aldrich) was used as the secondary antibody.

All yeast strains are based on W303 Rad5+ (see Figure 5—source data 2 for a complete list). yen1△ or yen1△ mus81△ strains were transformed with an integrative plasmid expressing mutant versions of YEN1. Freshly grown over-night cultures were diluted to 1x10⁷ cells/ml. 5-fold serial dilutions were spotted on YPD plates with/without MMS (methyl methanesulphonate, concentrations as indicated) and incubated for 2 days at 30°C. The expression of 3FLAG-tagged Yen1 constructs was verified by SDS-PAGE and Western Blot analysis. Proteins were detected using a mouse monoclonal anti-FLAG M2-peroxidase (HRP) antibody (Sigma-Aldrich, München, Germany).