Sybr green qpcr kit

Total RNA was extracted from using Trizol reagent (Invitrogen, California, USA), in accordance with the manufacturer’s instructions. cDNA was synthesized by using a ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan). The cDNA was amplified by the SYBR Green qPCR kit (TOYOBO, Osaka, Japan). β-actin gene expression was used for normalization. The following primer sequences were used: GRIM-19, Forward: 5’GGGGCCTTGATCTTTGGCTA3’, and Reverse: 5’AAGTCCTCAATCAGCAGGCG3’; IL1B, Forward: 5’GTGTCTTTCCCGTGGACCTT3’, and Reverse: 5’AATGGGAACGTCACACACCA3’; IL6, Forward: 5’CTTCTTGGGACTGATGCTGGT3’, and Reverse: 5’CTCTGTGAAGTCTCCTCTCCG3’; TNFa, Forward: 5’CGGGCAGGTCTACTTTGGAG3’, and Reverse: 5’ACCCTGAGCCATAATCCCCT3’; Beclin1, Forward: 5’AACCGCAAGATAGTGGCAGA3’, and Reverse: 5’CTCTCTGATACTGAGCTTCCTCC3’; LC3, Forward: 5’ATCGCGGACATCTACGAGC3’, and Reverse: 5’AGGTTTCCTGGGAGGCGTA3’; BNIP3, Forward: 5’TCAGCAATAATGGGAACGGG3’, and Reverse: 5’AGCTACTCCGTCCAGACTCAT3’; β-actin, Forward: 5’GGCTGTATTCCCCTCCATCG3’, and Reverse: 5’CCAGTTGGTAACAATGCCATGT3’. Relative gene expression levels were analyzed by 2^−ΔΔCT method.

Whole-cell RNA was extracted from transfected, infected, or uninfected mock cells at indicated time points using the RNAiso Plus kit (9109, TaKaRa, Japan). For nucleocytoplasmic separation assay, cytoplasmic and nuclear RNA were extracted using PARIS Kit (AM1921, ThermoFisher Scientific). The extracted RNA was reverse transcribed into cDNA using HiScript II QRT SuperMix for qPCR (R223-01, Vazyme, China). Each sample was triplicated for relative abundance analysis of individual mRNA transcripts from the viral genome or host factors, with 28 s mRNA serving as the normalizing reference. The RT-qPCR amplification reaction utilized the SYBR Green qPCR Kit (QPS-201, TOYOBO, Japan) with the following cycling conditions: initial denaturation at 95°C for 2 min, followed by 40 cycles of 95°C for 5 s, 60°C for 30 s, and a melt curve. The results were analyzed using the 2^-ΔΔC method.
To determine the viral loads of IBDV in infected cells, the Premix Ex Taq (Probe qPCR; R390B, TaKaRa, Japan) was employed with cycling conditions of 48°C for 30 min and 95°C for 20 s, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s. Specific primers and TaqMan probes for 28 s and the IBDV genome were synthesized by Invitrogen. The primers used in this study are available upon request.

Sodium arsenite (NaAsO₂), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), gallic acid, rutin, penicillin/streptomycin, hematoxylin, eosin, and protease inhibitor were purchased from Sigma-Aldrich (St. Louis, MO, USA). Fetal bovine serum (FBS), Dulbecco's modified Eagle's medium (DMEM), and other cell culture reagents were obtained from Gibco (Carlsbad, CA, USA). Dimethyl sulfoxide (DMSO) was from Bioshop (Canada). RNA extraction kits were purchased from RiboEx and Hybrid-R (Gene All, South Korea). Tissue protein extraction (T-PER), cDNA synthesis (ReverTra Ace qPCR RT Kit), and BCA protein assay kits were purchased from Thermo Scientific (Waltham, Massachusetts, USA). SYBR green qPCR kit was purchased from TOYOBO (Japan). Primary antibodies (phospho-ERK1/2, phospho-JNK phospho p38, Bax, Bcl-2, cleaved caspase-3, and caspase-3) and β-actin were purchased from Cell Signaling, Danvers, MA, USA. Secondary antibody (goat anti-rabbit IgG-HRP) was purchased from Santa Cruz (Santa Cruz, CA, USA). ECL detection kit was acquired from Abfrontire (South Korea), and the ALT and AST kits were from ASAN (South Korea). Lactate dehydrogenase (LDH) cytotoxicity assay kit was obtained from TAKARA (Japan), and the ROS detection kit was from Promega (USA). Zoletil 50 was supplied by Virbac S.A. (France).

Polyphenolic compounds, 3-(4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide (MTT), 2, 2′-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) disodium salt (ABTS), fluorometric intracellular ROS kit, penicillin/streptomycin, and 2-(4-amidinophenyl)-6-indolecarbami dine dihydrochloride (DAPI) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Parishin derivatives were bought from Chengdu Biopurify Phytochemicals Ltd. (Chengdu, Sichuan, China). Fetal bovine serum (FBS) was obtained from Young in Frontier Company (Seoul, Korea). 2,2-Diphenyl-1-picrylhydrazyl (DPPH) was bought from MedChemExpress (Princeton, NJ, USA). Ham’s F-12 Nutrient Mix medium, BCA protein assay kit, and cDNA synthesis kit (ReverTra Ace qPCR RT Kit) were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Eagle’s Minimum Essential Medium (EMEM) was obtained from ATCC (Manassas, VA, USA). H₂O₂ was purchased from Fujifilm Wako Pure Chemical (Osaka, Japan). The SYBR green qPCR Kit was supplied by TOYOBO (Osaka, Japan). Lactate dehydrogenase (LDH) cytotoxicity assay kit was bought from TAKARA (Shiga Prefecture, Japan). Clarity western chemiluminescent (ECL) substrate kit was supplied by Bio-Rad Laboratories (Hercules, CA, USA).

Total RNAs were extracted from 8-day-old seedlings using TRIzolR reagent (Invitrogen), incubated with DNAase (TaKaRa) and reverse transcribed (Toyobo). qPCR was carried out in a Bio-Rad CFX Connect Real-Time System using the SYBR Green qPCR kit (Toyobo). Amplification reactions were performed in a total volume of 20 μL, which contained 2 μL forward and reverse primers (1 μM), 1 μL cDNA, 10 μL SYBR Green premix, 7 μL distilled, deionized water. The procedure of qPCR was conducted as follows: 95°C for 10 min; 40 cycles of 95°C for 15 s and 60°C for 1 min. Relative expression levels were normalized to ACTIN2/8.
Sequences of used primers were listed in S2 Table.

Mice were sacrificed and the brain tissues containing Toxoplasma cysts were removed and homogenized in liquid nitrogen. Total RNA was extracted from brain homogenates using the Trizol reagent (Life Technologies. Inc, USA). Subsequently 1 μg of total RNA was used to synthesize the first-strand cDNA, following the instructions from the SYBR Green qPCR Kit (Toyobo co., Ltd, Japan). The cDNA was then used as template for real-time PCR using the SYBR Green method, following the manufacturer's instructions. Real time PCR was performed in a 20 μl volume on the ABI ViiA 7 system (Life Technologies. Inc, USA). The primers used in real time PCR were as follow: SAG1-Fw: 5′-TGCGATGTGGCGTTATGG, SAG1-Rv: 5′-TTTTATCTGGGCAGGTGACAACT; BAG1-Fw : 5′-GACTGAGCAGTGTCCGGTTA, BAG1-Rv: TTCCGTCGGGCTTGTAATTACT; β-tubulin-Fw: 5′-CACTGGTACACGGGTGAAGGT, β-tubulin-Rv: 5′-ATTCTCCCTCTTCCTCTGCG. The cycling conditions for real time PCR were set as: 95°C for 5 min, followed by 40 cycles of 95°C for 10 sec, 60°C for 10 sec, 68°C for 10 sec. The Ct value of each sample was recorded and the 2^ΔΔCt method was used to assess the gene expression changes, β-tubulin was included as internal control.

Total RNA content was extracted from the tissues using TRIzol Reagent (Invitrogen, CA, USA) and was reverse transcribed into cDNA using the PrimeScript RT reagent Kit (TaKaRa, Tokyo, Japan) according to the manufacturer’s instructions. The relative expression levels of mRNA and circRNA (normalized to β-actin) were analysed by the 2^−ΔCt relative quantification method, and the relative circRNA expression was calculated with the 2^−ΔCt method [19 (link)]. qPCR was performed using a SYBR Green qPCR kit (TOYOBO, Tokyo, Japan) in the StepOne PCR system (Applied Biosystems). Primer sequences are shown in Table 1.Table 1

Primers used for qPCR analysis of circRNA and mRNA levels

Target	Primer Sequence 5` to 3`
	Forward	Reverse
HIF1A	GTCTGCAACATGGAAGGTATTG	GCAGGTCATAGGTGGTTTCT
ACTB	GAGAAAATCTGGCACCACACC	GGATAGCACAGCCTGGATAGCAA
hsa_circ_0007798	CCTGGAAGAGATGGATCAGAAA	GCATGCACGGCAGAAATC