The largest database of trusted experimental protocols

Taq sybr green premix

Manufactured by Qiagen
Sourced in United Kingdom, United States, Germany

Taq SYBR Green premix is a ready-to-use solution for real-time PCR applications. It contains a thermostable DNA polymerase, SYBR Green I dye, and necessary buffers and reagents for efficient DNA amplification and detection.

Automatically generated - may contain errors

Lab products found in correlation

3 protocols using taq sybr green premix

1

Gene Expression Analysis of Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA was extracted using the Qiagen mRNA extraction kit, according to the manufacturer’s instructions (Qiagen, Manchester, United Kingdom). RNA quality and quantity were assessed by nanodrop analysis. The cDNA was generated by the reverse transcriptase reaction and used for real-time PCR (qRT-PCR). The following genes were studied: NSE, Asl1, Hes6, Nanog, Twist, Snail, E-cadherin, and Wnt-11 (corresponding primer sequences given previously [32 (link),33 (link)]). Analysis by real-time qPCR was performed using Taq SYBR Green premix (Qiagen, Manchester, United Kingdom), as reported before. Relative levels of mRNA expression were calculated using the Comparative CT/2-ΔΔCT method [33 (link),34 (link)]. RPII (RNA polymerase II) was used as the reference gene. [34 (link)] Experiments were performed three times as biological repeats with triplicate technical repeats, then statistical significance was analysed using a Student’s t-test.
+ Open protocol
+ Expand
2

Quantifying Gene Expression in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
mRNA was isolated using an mRNA extraction kit according to the manufacturer’s instructions (Qiagen, Germantown, MD, USA). RNA quality and quantity were assessed NanoDrop Spectrophotometer at 260 nm and 280 nm absorbance. cDNA was generated and the following genes were studied (corresponding primer sequences given in references in parentheses): Wnt-11, NSE, Hes6, Neuro D [16 (link)]; Nanog [30 (link)]; Vim, Snail, Twist, E-cadherin (CDH1) [31 (link)]. qRT-PCR analysis was done using Taq SYBR Green premix (Qiagen, Germantown, MD, USA) and the following conditions were used: 95 °C for 15 minutes, 40 cycles at 95 °C for 15 seconds, 60 °C for 1 minute and a dissociation stage (95 °C for 15 seconds, 60 °C for 1 minute, 95 °C for 15 seconds, 60 °C for 15 seconds). Relative levels of mRNA expression were calculated using the Comparative CT/2−ΔΔCT method [32 (link)] with RNA polymerase II (RPII) as the house-keeping gene for the in-cell-line-based studies [33 (link)].
+ Open protocol
+ Expand
3

TGF-β2 and Nicotinamide Riboside in HTM Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
In the TGF-β2 group, HTM cells were exposed to 10-ng/mL TGF-β2 for 48 hours; in the TGF-β2+NR group, cells were incubated with 10-ng/mL TGF-β2 and 1-mM NR for 48 hours. Total RNA was extracted following the manufacturer's instructions, and reverse transcription was carried out using the Magen HiPure Universal RNA Mini Kit (R4130; Guangzhou Angen Biotech, Guangdong, China). quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using Taq SYBR Green Premix (QIAGEN, Hilden, Germany). The relative mRNA expression was determined using the ΔΔCT method and GAPDH primer pairs were used as a reference control. Primer sequences were as follows: FN sense, AGACCAGCAGAGGCATAAGG, antisense, CCACTCATCTCCAACGGCATA; GAPDH sense, CGAHATCCCTCCAAAATCAA, antisense, GTCTTCTGGGTGGCAGTGA.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!