Heregulin β 1

Manufactured by R&D Systems

Sourced in United States

Heregulin-β 1 is a recombinant human protein produced in E. coli cells. It is a member of the epidermal growth factor (EGF) family and functions as a ligand for the HER3 and HER4 receptor tyrosine kinases.

Automatically generated - may contain errors

Lab products found in correlation

Verteporfin, by Merck Group (2 mentions) Forskolin, by Merck Group (2 mentions) Du145, by American Type Culture Collection (1 mentions) Lncap, by American Type Culture Collection (1 mentions) Thapsigargin, by Merck Group (1 mentions) Rwpe 1, by American Type Culture Collection (1 mentions) Lncap c4 2, by American Type Culture Collection (1 mentions) Gallein, by Bio-Techne (1 mentions) Rho activator 2, by Cytoskeleton (1 mentions) Bkm120, by Santa Cruz Biotechnology (1 mentions) P75ntr, by Abcam (1 mentions) Sdf 1, by R&D Systems (1 mentions) Dmem medium, by Lonza (1 mentions)

Close spelling variants of this product

Heregulin (2 citations)

5 protocols using heregulin β 1

Verteporfin Modulates Schwann Cell Signaling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary cells were treated with 2 and 10 μM Verteporfin (Sigma SML0534). At 4 h after treatment, cells were stimulated with 20 ng μl⁻¹ neuregulin-1 β isoform (heregulin-β 1, R&D Systems). RNA was harvested at 24 h after treatment, and cDNA was analyzed by RT-qPCR using the following primers:
18S (Forward: cgccgctagaggtgaaattct, Reverse: cgaacctccgactttcgttct),
ErbB2 (Forward: aggtctggagggaacatcct, Reverse: tgggatgcatgtgtctcagt),
Cdc42 (Forward: gctctggagatgcgttcatag, Reverse: gaagcaatattggctgccttg),
Egr2 (Forward: gcactctgtggccctagaaca, Reverse: ggctgagatggctcgagaaa),
Sox10 (Forward: cgaattgggcaaggtcaaga, Reverse: caccgggaacttgtcatcgt),
Itga6 (Forward: cgagagatcaacgacgagaaac, Reverse: tctttcctacaccctcctctatg),
Dag1 (Forward: ctcccagggtgtttcagact, Reverse: tcagagcaaccaaggtgaca).
The S16 rat Schwann cell line ^{56 (link)} was obtained from Richard Quarles, cultured as described ^{52 (link)}, and expresses relatively high levels of myelin genes ^{25 (link)}.

Poitelon Y., Lopez-Anido C., Catignas K., Berti C., Palmisano M., Williamson C., Ameroso D., Abiko K., Hwang Y., Gregorieff A., Wrana J., Asmani M., Zhao R., Sim F., Wrabetz L., Svaren J, & Feltri M. (2016). YAP and TAZ control peripheral myelination and the expression of laminin receptors in Schwann cells. Nature neuroscience, 19(7), 879-887.

+ Open protocol

+ Expand

Characterizing Prostate Cancer Cell Lines

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human prostate cancer cell lines (LNCaP, LNCaP-C4, LNCaP-C4-2, DU145, PC3) and normal prostate epithelial cells (RWPE1) were obtained from ATCC (Rockville, MD, USA). PC3-ML cells were obtained from Dr. Alessandro Fatatis (Drexel University, Philadelphia, PA, USA), as previously described [53 (link)]. BPH-1 cells were a kind gift from Dr. Cecilia Caino (University of Colorado, Denver, CO, USA). VCaP cells were kindly provided by Dr. Trevor M. Penning (University of Pennsylvania, Philadelphia, PA, USA). Heregulin-β1 was purchased from R&D Systems (Minneapolis, MN, USA) and FBS from Hyclone. BKM120 was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Gallein was purchased from Tocris Bioscience (Bristol, UK). Forskolin, A123187 and thapsigargin were obtained from Sigma-Aldrich (St. Louis, MO, USA). Rho Activator II was purchased from Cytoskeleton (Denver, CO, USA).

Baker M.J., Abba M.C., Garcia-Mata R, & Kazanietz M.G. (2020). P-REX1-Independent, Calcium-Dependent RAC1 Hyperactivation in Prostate Cancer. Cancers, 12(2), 480.

+ Open protocol

+ Expand

Purification of Schwann Cells from Rat Nerves

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Schwann cells were harvested and purified according to O’Neill et al.^{13 (link)}, modified from Raff et al.^{64 (link)}. Briefly Schwann cells were purified from P7 sciatic nerves of F344‐Tg(UBC‐EGFP)F455Rrrc (RRRC, Rat Resource and Research Centre) and cultured in DMEM with 5% FBS and supplemented with 0.5 μM forskolin (Sigma-Aldrich) and 50 nl/ml heregulin β1 (R&D Systems). Schwann cells were purified using an immunomagnetic positive selection kit (EasySep, Stem Cell Technologies), with the antibody p75^NTR (Abcam).

Whitehead M.J., McGonigal R., Willison H.J, & Barnett S.C. (2018). Heparanase attenuates axon degeneration following sciatic nerve transection. Scientific Reports, 8, 5219.

+ Open protocol

+ Expand

Verteporfin Modulates Schwann Cell Signaling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

T-47D and SK-BR3 cell culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

T-47D and SK-BR3 cells were obtained from ATCC (Manassas, VA) and were grown in DMEM medium (Lonza; Basel, Switzerland) supplemented with 10% FBS (Hyclone; Logan, UT). Heregulin β1 and SDF-1 were obtained from R&D (Minneapolis, MN).

Barrio-Real L., Wertheimer E., Garg R., Abba M.C, & Kazanietz M.G. (2016). Characterization of a P-Rex1 gene signature in breast cancer cells. Oncotarget, 7(32), 51335-51348.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!