Log In Sign up
The largest database of trusted experimental protocols

Ribogreen reagent

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The RiboGreen reagent is a fluorescent dye used for quantifying RNA in solution. It binds to RNA and emits fluorescent signals, allowing for the accurate measurement of RNA concentrations.

Automatically generated - may contain errors

Lab products found in correlation

Mirvana mirna isolation kit, by Thermo Fisher Scientific (4 mentions) Iscript cdna synthesis kit, by Bio-Rad (4 mentions) Miniopticon thermal cycler, by Bio-Rad (3 mentions) Ssofast evagreen supermix, by Bio-Rad (3 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions) Ssoadvanced sybr green supermix, by Bio-Rad (2 mentions) Cfx connect real time pcr detection system, by Bio-Rad (2 mentions) Tri reagent, by Merck Group (2 mentions) Agilent rna 6000 nano chip, by Agilent Technologies (2 mentions) 1mm silica zirconia beads, by Biospec (2 mentions) Mini beadbeater, by Biospec (2 mentions) Epoxides, by Merck Group (1 mentions) N methyl 1 phenylmethanamine, by Merck Group (1 mentions) Prolong diamond antifade mountant reagent, by Thermo Fisher Scientific (1 mentions) Bright glo luciferase assay substrate, by Promega (1 mentions) 3 4 5 dimethylthiazol 2 yl 2 5 diphenyltetrazolium bromide mtt, by Avantor (1 mentions) 1 palmitoyl 2 oleoyl sn glycero 3 phosphoethanolamine, by Avanti Polar Lipids (1 mentions) 1 2 dioleoyl sn glycero 3 phosphoethanolamine, by Avanti Polar Lipids (1 mentions) 1 2 distearoyl sn glycero 3 phosphocholine, by Avanti Polar Lipids (1 mentions) Random primer, by Thermo Fisher Scientific (1 mentions)

19 protocols using ribogreen reagent

1

Lipid Nanoparticle-mediated mRNA Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols
N-methyl-1-phenylmethanamine, Et3N, Pd/C, epoxides and other chemicals were purchased from Sigma-Aldrich. 1,2-distearoyl- sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and 1-palmitoyl-2-oleoyl- sn-glycero-3-phosphoethanolamine (POPE) were purchased from Avanti Polar Lipids, Inc. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Amresco (Solon, OH). Buffered formaldehyde (10%, pH 7.4) was purchased from Ricca Chemical (Arlington, TX). Firefly luciferase mRNA (FLuc mRNA) was purchased from TriLink Biotechnologies, Inc. (San Diego, CA). Alexa fluor 488 conjugate of wheat germ agglutinin, NucBlue Fixed cell ready probes DAPI, ProLong diamond antifade mountant reagent, Ribogreen reagent and fetal bovine serum (FBS) were purchased from Life Technologies (Grand Island, NY). Alexa-Fluor 647-labeled RNA was purchased from Integrated DNA Technologies. Bright-Glo luciferase assay substrate was from Promega (Madison, WI, USA).
Li B., Luo X., Deng B., Giancola J.B., McComb D.W., Schmittgen T.D, & Dong Y. (2016). Effects of local structural transformation of lipid-like compounds on delivery of messenger RNA. Scientific Reports, 6, 22137.
+ Open protocol
+ Expand
2

RNA Isolation and Quantification from PBMCs and Colonic Biopsies

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from PBMCs or Jurkat cells using TRIzol (Life Technologies). One μl of GlycoBlue (Life Technologies) was added before RNA precipitation with isopropanol. RNA was washed with 70% ethanol and resuspended in nuclease-free water. Equal amounts of total RNA were reverse-transcribed to generate cDNA using MultiScribe Reverse Transcriptase and random primers (Applied Biosystems). To extract RNA from colonic biopsies, each sample was immediately placed into RNA Stat-60 (Tel-Test) then placed on ice. Samples were stored at -80°C, and assays were performed within 6 months of acquisition. Colonic pinch biopsies were homogenized manually in the presence of RNA Stat-60 using chilled Kontes-Duall tissue grinders (Fisher Scientific). After the addition of chloroform and centrifugation, a crude RNA extract was obtained. The resultant aqueous phase was mixed with an equal volume of 70% ethanol; the samples were then loaded onto RNeasy Lipid Tissue Mini columns (Qiagen) according to the manufacturer's protocol. RNA was eluted in 40 μl of TE buffer. RNA was quantified using Ribo-green reagent (Life Technologies).
Boland B.S., Widjaja C.E., Banno A., Zhang B., Kim S.H., Stoven S., Peterson M.R., Jones M.C., Su H.I., Crowe S.E., Bui J.D., Ho S.B., Okugawa Y., Goel A., Marietta E.V., Khosroheidari M., Jepsen K.L., Aramburu J., Lopez-Rodriguez C., Sandborn W.J., Murray J.A., Harismendy O, & Chang J.T. (2015). Immunodeficiency and Autoimmune Enterocolopathy Linked to NFAT5 Haploinsufficiency. Journal of immunology (Baltimore, Md. : 1950), 194(6), 2551-2560.
+ Open protocol
+ Expand
3

Transcriptomic Profiling of Human Embryonic Stem Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
hESCs were grown in feeder-free conditions for 11-16 passages. Total RNA was purified from snap-frozen sample pellets using a mirVana miRNA Isolation Kit (Ambion), quantified using the Ribogreen reagent (Lifetech), and then quality assessed on a Bioanalyzer 2100 platform (Agilent). Two hundred nanograms of total RNA was amplified and labeled using the TotalPrep Kit (Ambion). Then the labeled product was hybridized to Illumina HT12v3 beadchips and scanned on a BeadArray Reader (Illumina) according to the manufacturer's instructions. In GenomeStudio, probes were filtered for those detected at P<0.01 in at least one sample and exported for normalization in R via robust spline normalization. Differential expression and ANOVA analyses were executed using Limma (Smyth, 2004 (link)). Hierarchical clustering was performed using Cluster, with Euclidian distance and complete linkage. Functional enrichments were executed in GREAT (McLean et al., 2010 (link)) with the ‘Association rule settings’ set to ‘Single nearest gene’. Microarray data have been deposited in Gene Expression Omnibus under accession number GSE63592.
Zdravkovic T., Nazor K.L., Larocque N., Gormley M., Donne M., Hunkapillar N., Giritharan G., Bernstein H.S., Wei G., Hebrok M., Zeng X., Genbacev O., Mattis A., McMaster M.T., Krtolica A., Valbuena D., Simón C., Laurent L.C., Loring J.F, & Fisher S.J. (2015). Human stem cells from single blastomeres reveal pathways of embryonic or trophoblast fate specification. Development (Cambridge, England), 142(23), 4010-4025.
+ Open protocol
+ Expand
4

Total RNA Isolation Using mirVana

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA, including small RNA species, was isolated from the cells by using a mirVana miRNA isolation kit according to the manufacturer’s instructions (Life Technologies, Carlsbad, CA, USA). Total RNA was then quantified using RiboGreen Reagent (Life Technologies).
Ishikawa K.I., Ishikawa A., Shoji Y, & Imai T. (2014). A Genotoxic Stress-Responsive miRNA, miR-574-3p, Delays Cell Growth by Suppressing the Enhancer of Rudimentary Homolog Gene in Vitro. International Journal of Molecular Sciences, 15(2), 2971-2990.
+ Open protocol
+ Expand
5

Synthesis and Characterization of mRNA Lipoplexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Firefly luciferase mRNAs (FLuc mRNAs) and enhanced green fluorescent protein mRNA (eGFP mRNAs) were purchased from TriLink Biotechnologies, Inc. (San Diego, CA). DOPE was purchased from Avanti Polar Lipids, Inc (Alabaster, AL). Ribogreen reagent and fetal bovine serum were purchased from Life Technologies (Grand Island, NY). Polymers (Table 1) and other chemicals were purchased from Sigma Aldrich and used without further purifications.
Zhao W., Zhang C., Li B., Zhang X., Luo X., Zeng C., Li W., Gao M, & Dong Y. (2018). Lipid Polymer Hybrid Nanomaterials for mRNA Delivery. Cellular and Molecular Bioengineering, 11(5), 397-406.
+ Open protocol
+ Expand
6

Quantifying Viral RNA Degradation by RNase

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ribonuclease activity was measured by quantifying tRNA fluorescence with Ribogreen reagent (Life Technology). Virus, RNase (A, S, S peptide, S protein) and virus-RNase conjugates were combined in PBS with 0.2–1 μg tRNA and Ribogreen (1 in 200 dilution) and fluorescence (485/520 nm) was measured using a BMG Optima plate reader. For RNase A activity during in vitro uncoating, 3H-U-PV was incubated at 50°C for 10 min in the presence or not of RNase A (1 mg/ml). Immediately after incubation, the entire reaction volume was loaded onto a 15–30% sucrose gradient and processed as above. Similarly, 3H-U-PV conjugated to RNase-A was uncoated in vitro and the RNA analyzed on a sucrose gradient.
Groppelli E., Levy H.C., Sun E., Strauss M., Nicol C., Gold S., Zhuang X., Tuthill T.J., Hogle J.M, & Rowlands D.J. (2017). Picornavirus RNA is protected from cleavage by ribonuclease during virion uncoating and transfer across cellular and model membranes. PLoS Pathogens, 13(2), e1006197.
+ Open protocol
+ Expand
7

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was obtained from tibialis muscles using the TRI Reagent following manufacturer’s instructions. RNA concentration was determined fluorometrically using the Ribogreen reagent (Invitrogen, Carlsbad, CA, USA). Total mRNA was retro-transcribed using the i-Script cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Transcript levels were determined by real-time PCR using the SsoAdvanced SYBR Green Supermix and the CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Primer sequences are given in the Supplemental Material section (Table S1).
Ballarò R., Penna F., Pin F., Gómez-Cabrera M.C., Viña J, & Costelli P. (2019). Moderate Exercise Improves Experimental Cancer Cachexia by Modulating the Redox Homeostasis. Cancers, 11(3), 285.
+ Open protocol
+ Expand
8

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was obtained using TriReagent (Sigma Aldrich, St. Louis MO) following the manufacturer’s instructions. RNA concentration was determined fluorometrically using the RiboGreen reagent (Invitrogen, Carlsbad CA).
Total mRNA was retrotranscribed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Transcript levels were determined by real-time PCR using the SsoFast EvaGreen Supermix and the MiniOpticon Thermal Cycler (Bio-Rad). Ten seconds of denaturation at 95 °C was followed by 30 seconds of annealing/extension at 60 °C and repeated for 40 cycles. Every qPCR was validated by analyzing the respective melting curve. Only one peak was detectable, indicating the presence of just one amplicon.
Gene expression was normalized to both GAPDH and TATA-binding protein (TBP) expression and calculated using the 2−ΔΔCt method.
Primers sequences used (forward and reverse) are indicated in Supplementary Table S1 (see supplementary information).
Aversa Z., Pin F., Lucia S., Penna F., Verzaro R., Fazi M., Colasante G., Tirone A., Fanelli F.R., Ramaccini C., Costelli P, & Muscaritoli M. (2016). Autophagy is induced in the skeletal muscle of cachectic cancer patients. Scientific Reports, 6, 30340.
+ Open protocol
+ Expand
9

Quantifying mRNA Levels by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was obtained using TriPure isolation reagent (Roche Applied Science, Indianapolis, IN) following the manufacturer's instructions. RNA concentration was determined fluorometrically using RiboGreen reagent (Invitrogen, Carlsbad, CA). RNA integrity was checked by electrophoresis on 1.2% agarose gel containing 0.02 mol/L morpholinopropanesulfonic acid and 18% formaldehyde. Total mRNA was retrotranscribed using an iScript cDNA synthesis kit (Bio-Rad Laboratories). Transcript levels were determined by real-time PCR using the SsoFast EvaGreen supermix and the MiniOpticon thermal cycler (Bio-Rad Laboratories), normalizing the expression for TBP. Primer sequences (Invitrogen, Carlsbad, CA) were as follows:
VDR FW CCTCATAAAGTTCCAGGTGGGG
VDR RV GGATAGGCGGTCCTGAATGG
TBP FW TGTCCAGAGCACCAACAGTC
TBP RV TAACAGCAGCAAAACGCTTG
Camperi A., Pin F., Costamagna D., Penna F., Menduina M.L., Aversa Z., Zimmers T., Verzaro R., Fittipaldi R., Caretti G., Baccino F.M., Muscaritoli M, & Costelli P. (2017). Vitamin D and VDR in cancer cachexia and muscle regeneration. Oncotarget, 8(13), 21778-21793.
+ Open protocol
+ Expand
10

Isolation and Extraction of Total RNA and Axoplasm from Rat Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from rat L4–L6 DRGs and brain were isolated using phenol–chloroform extraction followed by ethanol precipitation. To isolate the axoplasm from the rat sciatic nerve, a mechanical squeezing method was used, as described previously 17. Briefly, the sciatic nerves were cleaned from the surrounding connective tissues using ultrafine forceps in cold phosphate‐buffered saline. The sciatic nerve was cut into segments of approximately 10 mm in length using a surgical blade. Then, the axoplasm was carefully squeezed manually using a pestle fit into a 1.5 mL microcentrifuge tube containing the lysis buffer on ice. Nucleic acids were isolated with the RNAqueous™‐Micro Total RNA Isolation kit (Ambion, Austin, TX, USA). The concentration of RNA extracted was determined by the VersaFluor™ fluorometer (Bio‐Rad, Hercules, CA, USA) using RiboGreen™ reagent (Invitrogen, Carlsbad, CA, USA) and then stored at −80 °C until use.
Shrestha S., Phay M., Kim H.H., Pouladvand P., Lee S.J, & Yoo S. (2019). Differential regulation of brain‐derived neurotrophic factor (BDNF) expression in sensory neuron axons by miRNA‐206. FEBS Open Bio, 9(2), 374-383.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!