Sybr green master mix 2

TRIzol reagent (Sigma, USA) was used for total RNA isolation. MicroRNA reverse transcription kit (Takara, Dalian, China) was used to reverse transcribe cDNA. RT-qPCR assay was performed by using SYBR Green Master Mix II (Takara). U6 and GAPDH are used as internal references. The relative expression of miR-448 and ROCK1 was calculated by the 2^−△△ct method. The primer sequences have been shown in Table 1.

TRIzol reagent (Invitrogen, CA, USA) was used to extract total RNAs from both tissues and cells. The cDNA synthesis was conducted using PrimeScript RT reagent (Takara, Kusatsu, Japan) and total RNAs. Real-time PCR was performed using an ABI 7900 fast real-time PCR system (ABI, CA, USA) and SYBR Green Master Mix II (Takara). GAPDH and small RNA RNU6B (U6) were used to normalize mRNA and miRNA levels, respectively, and quantified using the 2^−ΔΔCT method. Each sample was run in triplicate using samples from independent experiments. The primers used in this study are shown in Table 2.Table 2

Quantitative real-time PCR primers used in this study

Gene name	Primer sequence (5′ to3′)	Amplicon size (bp)
HOXA11-AS	Forward: TTGCCAATCGGGTCACAGCGG Reverse: TCCAGTGCTGGTCTTCGTTGA	278
miR-518a-3p	Forward: CGTCGTTCATGGCGGACTT Reverse: CTTGGGAAAGTGCTTCGTT	193
PDK1	Forward: CTTGAATTCGAGTGCGGAGA Reverse: GCCGGCCAAGACTCGAGTTT	252
GAPDH	Forward: TGAAGGTCGGAGTCAACGGA Reverse: CCTGGAAGATGGTGATGGGAT	225
U6	Forward: CTCGCTTCGGCAGCACA Reverse: AACGCTTCACGAATTTGCGT	257

TRIzol reagent (Invitrogen, CA) was mixed with tissue or cells to extract total RNAs. We used PrimeScript RT reagent (Takara, Japan) for reverse transcription reaction, and SYBR Green Master Mix II (Takara) for PCR reactions. PCR was performed on an ABI 7900 fast real-time PCR system (ABI, CA). U6 or Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was employed as an endogenous control. Reactions were conducted three times, and data were analyzed using the 2^-ΔΔCT method. The following real-time PCR primers were used in this study: circRANBP17: Forward, 5'- CTCCAGGGTACTGTGGAACA-3' and Reverse, 5'-TCCAAGAGTGCTTTCTCAGC-3'; miR-635: Forward, 5'-AGTGCGTGTCGTGGTGT-3' and Reverse, 5'- GCCTGAGATGAAGCACGTG-3'; GAPDH: Forward, 5'-GGGAAACTGTGGCGTGAT-3', Reverse, 5'-GAGTGGGTGTCGCTGTTGA-3'; U6: Forward, 5'-CTCGCTTCGGCAGCACA-3', Reverse, 5'-AACGCTTCACGAATTTGCGT-3'.

The extraction of total RNA was performed using TRIzol reagent (Invitrogen, Carlsbad, USA). The cDNA solution was synthesized using PrimeScript RT reagent (Takara, Dalian, China). We conducted RT-qPCR using SYBR Green Master Mix II (Takara) on 7500 Fast Real-Time PCR system (ABI, CA, USA). miR-192 or RB1 was normalized to U6 or GAPDH internal reference using the 2^−△△ct method. The primers used in our work were as follows: miR-192, forward primer: 5′-GCG GCG GCT GAC CTA TGA ATT G-3′, reverse primer: 5′-ATC CAG TGC AGG GTC CGA GG-3′; U6, forward primer: 5′-CTC GCT TCG GCA GCA CA-3′, reverse primer: 5′-AAC GCT TCA CGA ATT TGC GT-3′; RB1 forward primer: 5′-GAA CAT CGA ATC ATG GAA TCC CT-3′, reverse primer: 5′-AGA GGA CAA GCA GAT TCA AGG TGA T-3′; GAPDH forward: 5′-ACA TCG CTC AGA CAC CAT G-3′, reverse: 5′-TGT AGT TGA GGT CAA TGA AGG G-3′.

Total RNA extraction was performed using TRIzol reagent (Invitrogen, USA). The cDNA solution was synthesized using a PrimeScript RT reagent kit (Takara, Dalian, China). RT-qPCR assay was performed on ABI 7300 real-time PCR system (Applied Biosystems, Waltham, MA) using SYBR Green Master Mix II (Takara). HCG11 and miR-942-5p expression were normalized to U6, while BRMS1 was normalized to GAPDH. Their expressions were quantified with the 2^−△△cq method. The primers used were as follows: HCG11 forward 5′-AGG AGT GGT TGC ATT TGG GA-3′′; HCG11 reverse 5′′-CCC ACC ACG CAG TGA ATA GT-3′; miR-942-5p forward: 5′-GCC AGA TCT TGA TTG ACT TAC AGC CCA GTT-3′ and reverse, 5′-GCC GAA TTC CAC CTG TCT TTA TTC CAC CC-3′; U6-forward: 5′-GCT TCG GCA GCA CAT ATA CTA AAA T-3′ and reverse, 5′-CGC TTC ACG AAT TTG CGT GTC AT-3′; BRMS1 forward: 5′-CAG CCT CCA AGC AAA GAC AC-3′ and reverse, 5′-GCG GCG TCG CTC ATA GTC-3′; GAPDH forward: 5′-ACA ACT TTG GTA TCG TGG AAG G-3′, and reverse, 5′-GCC ATC ACG CCA CAG TTT C-3′.

The extraction of mRNA was performed using TRIzol reagent (Invitrogen, Carlsbad, USA). RT‐qPCR was performed using SYBR Green Master Mix II (Takara) and corresponding primers. U6 or GAPDH was standardized as endogenous controls by miR‐374b or ITGB1. The relative expression of miR‐374b or ITGB1 was detected by 2^−△△ct method. The primers are shown in Table 1.