ADAM15 steady-state mRNA levels were quantified in human frozen lung samples or AMs obtained from patients with COPD, smokers, and non-smokers. Total RNA was isolated from lung samples or AMs using a SurePrep TrueTotal RNA Purification Kit (Fisher Scientific, Fair Lawn, NJ), following the manufacturer’s instructions, and 1 μg of RNA was reverse transcribed into cDNA using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Carlsbad, CA). A SYBR green-based real-time RT-PCR assay was used to measure ADAM15 gene expression using primers for ADAM15 (forward primer 5′- CAGGACGATCTCCCAATTAGC − 3′; reverse primer 5′- GGACCAACTCCCTATTCTGTAGC-3′) from Invitrogen (Charlestown, MA) and primers for peptidylprolyl isomerase A (PPIA) as the housekeeping gene (forward primer 5′- CTCGAATAAGTTTGACTTGTGTTT − 3′; reverse primer 5′- CTAGGCATGGGAGGGAACA − 3′), the comparative threshold method, and an AriaMx Real-time PCR machine (Agilent technologies, Santa Clara, CA).
Ariamx real time pcr machine
Manufactured by Agilent Technologies
Sourced in United States, United Kingdom
The AriaMx Real-Time PCR machine is a laboratory instrument designed for nucleic acid amplification and detection. It utilizes real-time PCR technology to monitor the progress of a PCR reaction in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Goscript reverse transcription system, by Promega (8 mentions)
Trizol, by Thermo Fisher Scientific (7 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (7 mentions)
Goscript reverse transcription mix, by Promega (5 mentions)
Eastep super total rna extraction kit, by Promega (5 mentions)
Rneasy mini kit, by Qiagen (5 mentions)
Turbo dnase, by Thermo Fisher Scientific (4 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Takara Bio (3 mentions)
Hieff qpcr sybr green master mix, by Yeasen (3 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (3 mentions)
Trizol extraction, by Thermo Fisher Scientific (3 mentions)
Sureprep truetotal rna purification kit, by Thermo Fisher Scientific (2 mentions)
Precisionfast qpcr master mix, by Primerdesign (2 mentions)
Hiscript 2 q rt supermix, by Vazyme (2 mentions)
Primer express software version 3, by Thermo Fisher Scientific (2 mentions)
Murine ribonuclease inhibitor, by New England Biolabs (1 mentions)
Rnase r, by Illumina (1 mentions)
Accuscript high fidelity 1st strand cdna synthesis kit, by Agilent Technologies (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
36 protocols using ariamx real time pcr machine
1
ADAM15 Expression in COPD Lungs
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted with TRIzol reagent (Takara) according to the manufacturer’s instructions. For mRNAs and lncRNAs, reverse transcription was carried out using GoScript™ Reverse Transcription Mix (Promega) with random primers. For miRNA analysis, a Bulge-Loop™ miRNA qRT-PCR primers set (one RT primer and a pair of qRT-PCR primers for each set) specific for miR-423-5p was designed and synthesized (RiboBio). RT-qPCR analysis was performed using Hieff® qPCR SYBR Green Master Mix (Yeasen) and AriaMx Real-Time PCR machine (Agilent Technologies). Actin and U6 were used as internal controls and all reactions were repeated in three independent experiments. The expression of genes measured was normalized to endogenous controls, and the relative quantification (2−ΔΔCt) method was used for fold-change calculation. The primers were listed in Additional file 2 : Table S1.
3
RNA Isolation and Circular RNA Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated by TRIzol which were treated with RNase R (Epicentre) (10 units/µg RNA) in RNase R buffer supplemented with murine Ribonuclease Inhibitor (New England Biolabs) at 37 °C for 1 h. First-strand cDNA synthesis from RNase R-treated RNA was carried out using GoScript™ Reverse Transcription Mix (Promega, random primers), followed by quantitative PCR (qPCR) using AriaMx Real-Time PCR machine (Agilent Technologies).
4
Quantitative Analysis of Transcript Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the steady-state level of transcripts, total RNA was extracted from the root tips of 4-day-old seedlings and treated with RNase-free DNase I. One microgram of total RNA was used for the reverse transcription using the AccuScript High Fidelity 1st Strand cDNA synthesis kit (Agilent Technologies, 200820), and 1 µl of resulting first-strand cDNA (20 µl) was used as a PCR template for the quantitative real-time RT-PCR. Quantitative PCR analysis was performed using SYBR Premix EX Taq (Takara, #RR82LR) with an AriaMx real-time PCR machine (Agilent Technologies). EF1 was used as an internal reference to normalize the relative level of each transcript. Each experiment was repeated three times, and each time the experiment included triplicate samples. The raw data underlying the averages are shown in Source Data file.
5
Genetic Markers for Mosquito Resistance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from whole mosquitoes using the DNeasy kit (Qiagen, Hilden, Germany) and used as a template for molecular analyses. The Vgsc genotype at codon 1014 (995 using An. gambiae (s.s.) numbering) (The Anopheles gambiae 1000 Genomes Consortium, 2017 (link)) were determined using a locked nucleic allele (LNA) assay, which detects wild type and kdr mutants serine or phenylalanine (Lynd et al., 2018 (link)). The triple mutation with Cyp6aa1 duplication, Cyp6p4-I236M and ZZB-TE (cytochrome p450-linked ‘Zanzibar-like’ transposable element) was assessed using three independent LNA assays (Njoroge et al., 2021 ). All assays were run on AriaMx Real-Time PCR machine (Agilent, Santa Clara, USA). TaqMan assays were used to genotype Cyp4j5 and Coeae1d (Weetman et al., 2018 (link)). TaqMan assays used a primer/probe mix in addition to 1× sensimix (Bioline) and DNA template (1 μl) in a 10 μl volume reaction with denaturing for 5 min at 95 °C, followed by 40 cycles of denaturing for 15 s at 92 °C and annealing for 1 min at 60 °C. The TaqMan assays were performed on an Agilent MX3005P Real-Time PCR machine.
6
siRNA Transfection and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA transfections were performed using Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Total RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega, Madison, WI, USA) following the manufacturer’s protocol. First-strand cDNA synthesis from total RNA was carried out using GoScript Reverse Transcription System (Promega, Madison, WI, USA), followed by qPCR using AriaMx Real-Time PCR machine (Agilent Technologies, Santa Clara, CA, USA). Data presented were the normalized values to control samples after normalization to the expression of β-actin. Standard error of the mean (SEM) is depicted.
7
Quantifying Gene Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Taqman RT-qPCR was performed to measure and quantify gene expression. Primers and probe sequences were designed using Primer Express Software Version 3.0.1 (Applied Biosystems Inc., Foster City, CA, USA https://www.thermofisher.com/uk/en/home/technical-resources/software-downloads/primer-express-software-download.html ) (Supplementary Table 1 ). Precision FAST qPCR Master Mix (Primerdesign, Camberley, UK) and AriaMx Real-Time PCR machine (Agilent Technologies) were used to performed RT-qPCR. Each reaction included 3 µl of cDNA, 6.5 µl of master mix, 0.4 µl of forward primer (10 µM), 0.4 µl of reverse primer (10 µM), 0.25 µl of probe (10 µM) and 2.45 RNase-free water. The RT-qPCR conditions comprised a preliminary cycle of 95 °C for 2 min followed by 40 cycles of 95 °C for 5 s and 60 °C for 20 s. The target gene expression was normalized with human GAPDH or murine β-actin and gene expression was calculated using the relative standard curve method29 (link).
8
RNA Extraction and RT-qPCR for Transposable Element Expression
9
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol (Invitrogen) following the manufacturer's protocol. First‐strand cDNA synthesis from total RNA was carried out using GoScript™ Reverse Transcription Mix with random primers (Promega), followed by quantitative PCR (qPCR) using AriaMx Real‐Time PCR machine (Agilent Technologies). All RT‐qPCRs were repeated at least three times, and the relative abundance of each transcript was normalized to the expression level of ACTIN. Sequence information for all primers used to check both gene expression and circPVT1 expression was presented in Table EV1 .
10
RNA Isolation, cDNA Synthesis, and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by TRIzol extraction (Thermo) using the standard procedure. Isolated RNA was treated with TURBO DNase (Invitrogen) following the manufacturer’s instructions followed by cDNA preparation from 1 μg RNA using Superscript III reverse transcriptase (Invitrogen) and a mix of 80 pmol random primers and 20 pmol dT20 primers. qPCR was performed using Platinum SYBR Green using an AriaMx Real-Time PCR machine (Agilent). Primers for RTqPCR are listed in Table S3 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!