Platinum sybr green qpcr supermix udg reagent

To validate the sequencing data, quantitative RT-PCR was carried out in 16 NPC and 16 NNET tissues for eight genes (JAG1, IRF1, EGLN1, TIMP3, WDR5, SMAD3, FNDC3B, and XRCC5) with extreme 3’UTR length differences between NPC and NNET. Based on SAPAS data, the poly(A) sites of each gene were divided into two supersites: “proximal sites” and “distal sites”. Two gene-specific primer sets were specifically designed for “proximal sites” and “distal sites”, as described previously [30 (link)]. Primer sequences are listed in Additional file 1. The quantitative RT-PCR was performed on the CFX96TouchTM sequence detection system (Bio-Rad, Hercules, CA, USA) using Platinum SYBR Green qPCR SuperMix-UDG reagents (Invitrogen) according to the manufacturer’s instructions. GAPDH was used as a control for normalization. For each gene, the relative expression ratio of the proximal site to the distal site was calculated using the 2^-ΔΔCT method [42 (link)].

Total RNA was extracted from freshly frozen samples or cells using the TRIzol reagent (Invitrogen). Total RNA was reverse-transcribed using a First Strand cDNA Synthesis Kit (Invitrogen). The real-time PCR reactions were conducted using Platinum SYBR Green qPCR SuperMix-UDG reagents (Invitrogen) on an Applied Biosystems 7500 Sequence Detection system. All reactions were done in triplicate and reactions without reverse transcriptase were used as negative controls. The human α-tubulin gene was used as the endogenous control and the 2^−ΔΔCT equation was used to calculate the relative expression levels. The primers used to detect gene expression are shown in supplemental Table S3.

The kits mentioned below were used following the manufacturer’s instructions. Total RNA of tissues or cells was extracted using the TRIzol reagent (Invitrogen), and used to synthesize cDNA with a reverse-transcription kit (Promega, Madison, WI, USA). Then, the cDNA was used as a template to perform quantitative real-time PCR reactions using Platinum SYBR Green qPCR SuperMix-UDG reagents (Invitrogen) on an SFX (96) system (Bio-Rad, Hercules, CA, USA). The primers used are shown in Supplementary Table 1.

Total RNA from cells and tissues was extracted using the TRIzol Reagent (Invitrogen). The cDNAs were synthesized using HiScriptIII RT SuperMix (Vazyme). The quantitative real-time PCR (qPCR) assays were conducted using the cDNA as the template with a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules) with Platinum SYBR Green qPCR SuperMix-UDG reagents (Invitrogen). The threshold cycle number (CQ) was analyzed in triplicate for each sample. GAPDH (encoding glyceraldehyde-3-phosphate dehydrogenase) was used as the internal control for CQ value normalization. The primer sequences used for qPCR are shown in Table S3.

Total RNA was extracted using TRIzol reagent (Invitrogen) as described previously [16 (link)]. Reverse transcribed using Bulge-Loop miRNA-specific RT primers (RiboBio, Guangzhou, China) for miR-203a-3p or random primers (Promega) for LASP1 with M-MLV reverse transcriptase (Promega, Madison, WI, USA). Quantitative RT-PCR reactions were performed on the ABI 7300 (Applied Bio-systems) using Platinum SYBR Green qPCR SuperMix-UDG reagents (Invitrogen). U6 or GAPDH were used as internal controls for miR-203a-3p and LASP1, respectively. The relative expression levels were calculated as previously described [16 (link)].

Total RNA was extracted from cell lines and freshly frozen samples with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and was reverse-transcribed with the first-strand cDNA synthesis kit (Invitrogen). Real-time PCR reactions were conducted using Platinum SYBR Green qPCR SuperMix-UDG reagents (Invitrogen). Reverse transcriptase was used as the negative control, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control. All experiments were repeated twice. The 2^-ΔΔCT equation was used to calculate the relative expression levels. The PCR primers used in this study were as follows: NUSAP1 (5′: GAAGCGCGGCATTCTTCATT, 3′: CGGCGATACTCGGAAGATGG), GAPDH (5′: CACCATCTTCCAGGAGCGAG, 3′: GACTCCACGACGTACTCAGC), GLI1 (5′: GCTCTGGACATACCCCACCT,3′: GCAGCTCCCCCAATTTTTCTG), PTCH1 (5′: TCGCTCTGGAGCAGATTTCC, 3′: TCTCGAGGTTCGCTGCTTTT), HIP1 (5′: GGCGACATGGATCGGATGG, 3′: ACAGCCACTTCCTGCGTATT), CCND1 (5′: AAAGAATTTGCACCCCGCTG, 3′: GACAGACAAAGCGTCCCTCA), CCNE1 (5′, GCAGGATCCAGATGAAGAAATG, 3′: TAATCCGAGGCTTGCACGTT), HDAC1 (5′: TGCAAAGAAGTCCGAGGCAT, 3′: ACCCTCTGGTGATACTTTAGCA).