Pet28b

CCHFV Kelkit06 NP (1449 bp) retrieved from GenBank (Accession no. GQ337053) was optimized for bacterial expression, synthesized, and cloned into pUC19 by GenScript USA Inc. (Nanjing, Jiangning, China) and then, propagated in DH5α Escherichia coli cells. For the expression, CCHFV NP was subcloned into pET28b (Addgene, Cambridge, USA) by using XhoI (Sigma-Aldrich, Taufkirchen, Germany) and NcoI (New England Biolabs, Massachusetts, USA) restriction enzymes and transformed into One Shot BL21(DE3) Chemically Competent E. coli cells (Thermo Fisher Scientific, Waltham, USA). After transformation, positive transformants were selected with kanamycin and analyzed by sequencing.

AtAPx-R (At4g32320) coding sequences (CDS) with and without stop codon were amplified from Arabidopsis thaliana leaf cDNA sample using the following primers: FOR (5′ CACCATGACGACGACGACT 3′), REV_STOP (5′ TCATAACATATTCCATTTGGCCC 3′) or REV_NOSTOP (5′ TAACATATTCCATTTGGCCC 3′). The amplified sequences were cloned into pENTR/D-TOPO (Thermo Fisher Scientific, Waltham, MA, USA) and recombined with the respective destination vector using Gateway LR Clonase II Enzyme Mix (Thermo Fisher Scientific). For protoplasts assays, APx-R CDS with and without stop codon were cloned into p2YGW7 [23 (link)] and pART7 [24 (link)] vectors, respectively. Overexpression construct was obtained through APx-R CDS cloning into pEARLEYGATE101 vector [25 (link)]. A codon optimized version of mature AtAPx-R (Figure S1) was synthesized and cloned into pET28b (Addgene) to allow the expression of a His-tagged protein in E. coli cells. The determination of APx-R transit peptide was based on ChloroP Prediction Server (http://www.cbs.dtu.dk/services/ChloroP/).