The largest database of trusted experimental protocols

Anti β actin primary antibody

Manufactured by Cell Signaling Technology
Sourced in United States, China

Anti-β-actin primary antibodies are used to detect the presence and quantify the levels of the β-actin protein, a highly conserved and ubiquitously expressed cytoskeletal protein, in various biological samples. These antibodies can be used in techniques such as western blotting, immunohistochemistry, and flow cytometry to investigate the expression and distribution of β-actin.

Automatically generated - may contain errors

13 protocols using anti β actin primary antibody

1

Western Blot Analysis of Protein Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols
The protein concentration in the supernatant fluid was measured by BCA protein assay. Equal amounts of protein were subjected to SDS-PAGE and transferred to PVDF membranes. The transferred proteins were blocked with 5% skim milk and then incubated overnight with anti-TLR4, anti-occludin, and anti-β-actin primary antibodies (Cell Signaling Technology Inc., NY, USA), respectively. Immunoreactivity was detected with horseradish peroxidase conjugated secondary antibodies (Sigma Chemical Co., St. Louis, MO, USA) and visualized by enhanced chemiluminescence detection film.
+ Open protocol
+ Expand
2

Protein Extraction and Western Blot Analysis of Mouse Mammary Gland

Check if the same lab product or an alternative is used in the 5 most similar protocols
Euthanized mice had their mammary gland tissue removed, and 30 mg of mammary gland tissue was digested with 300 μl of RIPA buffer (Thermo Fisher, Shanghai, China) under ultrasound exposure for 30 min at 4°C. The samples were centrifuged at 13,800 × g for 20 min at 4°C. After isolating proteins by PAGE, the membranes were blocked with 5% pure milk for 2 h at room temperature (RT) and then washed with TBST (Thermo Fisher, Shanghai, China). The membranes were incubated with anti-EGFP (Biorbyt, Wuhan, China) and anti-β-actin primary antibodies (Cell Signaling Technology, Shanghai, China) overnight at 4°C. Then, the membranes were incubated with a secondary antibody for 1 h. ECL (Thermo Fisher, Shanghai, China) was used for substrate coloration.
+ Open protocol
+ Expand
3

Evaluating Inflammatory Cytokines by Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell lysates were electrophoresed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10% acrylamide). The separated proteins were transferred to a polyvinylidene fluoride (PVDF) membrane and immunoblotted with anti-IL-1β, anti-IL-6, and anti-β- actin primary antibodies (Cell Signaling Technologies, Beverly, MA), followed by incubation with their respective peroxidase-conjugated secondary antibodies. Reactive antibodies bound to their respective antigens were visualized using the ECL chemiluminescent detection system (Amersham, Piscataway, NJ) and the image captured using a UVP gel/blot Imaging System (Analytik Jena, Upland, CA) and analyzed using the UVP Imaging Software. β-actin was used as a loading control. Fold changes in protein expression were evaluated with respect to their appropriate controls.
+ Open protocol
+ Expand
4

Molecular Mechanisms of 2ME2 Inhibition

Check if the same lab product or an alternative is used in the 5 most similar protocols
2-Methoxyestradiol (2ME2) was purchased from Selleck (Houston, TX, USA). RPMI 1640, Ham's F-12K and fetal bovine serum were purchased from Gibco/BRL Life Technologies (Grand Island, NY, USA). Anti-HIF-1α primary antibodies were purchased from BioWorld (St Louis Park, MN, USA). Lamin B1 antibodies were obtained from Thermo Fisher Scientific (Waltham, MA, USA). Anti-β-actin primary antibodies were obtained from Cell Signaling Technology (Boston, MA, USA). Their respective horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from Beyotime (Shanghai, China). PVDF membranes were purchased from Bio-Rad (Richmond, CA, USA). The enhanced chemiluminescence (ECL) agent was obtained from Thermo Fisher Scientific (Waltham, MA, USA). An Immunol Fluorescence Staining Kit with Alexa Fluor 555-Labeled Donkey Anti-Rabbit IgG and 2-(4-amidinophenyl)-6-indolecarbamidine (DAPI) were obtained from Beyotime (Shanghai, China). TRIzol was purchased from Invitrogen (Grand Island, NY, USA), and One Step PrimeScript RT-PCR Kit was obtained from TaKaRa (Dalian, Liaoning, China).
+ Open protocol
+ Expand
5

Western Blot Analysis of Sirtuins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells and mice tissue were lysed in RIPA buffer with PMSF (Beyotime, Shanghai, China), and then protein was adjusted to the same level, added loading buffer and boiled at 100 °C for 5 min. A 50µg mass of protein lysates were loaded on 10% SDS-PAGE gels and transferred using PVDF membranes. After block, the membranes were incubated overnight with anti-SIRT3 (1:1000; Thermo, Waltham, MA, USA), anti-SIRT4 (1:1000; Thermo, Waltham, MA, USA), anti-SIRT5 (1:1000; Proteintech, Wuhan, Hubei, China) or anti-β-actin primary antibodies (1:1000; Cell Signaling Technology, Danvers, MA, USA), followed by incubation with appropriate secondary antibodies (1:10,000; Cell Signaling Technology, MA, USA) at 37 °C for 1h. The signal was visualized and captured with a ChemiDoc XRS+system (Bio-Rad, Hercules, CA, USA).
+ Open protocol
+ Expand
6

Primer Sequences and Antibody Details

Check if the same lab product or an alternative is used in the 5 most similar protocols
The primer sequences are listed in
Table 1. All plasmid constructs were confirmed by sequencing. The listed antibodies were used in this study including anti-p65 primary antibody (AnaSpec, USA) and anti-phospho-p65, anti- phospho-IκBα, and anti-β-actin primary antibodies (Cell Signaling Technology, USA); and anti-phospho-c-Fos, anti-phospho-c-Jun, anti-c-Fos and anti-c-Jun (Abcam, UK). Fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse or anti-rabbit IgG and horseradish peroxidase (HRP)-conjugated anti-mouse or anti-rabbit IgG antibodies were purchased from Beyotime Biotechnology (Beyotime, China).

Primers used in this study.

Table 1
PrimerForward (5′→3′)Reverse (5′→3′)
qIL-8CCACACCTTTCCACCCCAAATTGTTGCTTCTCAGTTCTCTTCA
qGAPDHCCTTCCGTGTCCCTACTGCCAACGACGCCTGCTTCACCACCTTCT
IL-8 F0GAGAGCAGTAATCTCTCCTGGGAAGGCAACAGCCAGTITGGAAGT
IL-8 F1GCTCAATGCTGCTGAAAACAGAAGGCAACAGCCAGTITGGAAGT
IL-8 F2CCAATCATTAGAGGAGTCAGGAAGGCAACAGCCAGTITGGAAGT
IL-8 F3GATGGTTGCG TAGTGTGGAATGAAGGCAACAGCCAGTITGGAAGT
IL-8 F4GCACATGTTCCCTACTCTTGGAAGGCAACAGCCAGTITGGAAGT
pCAGGS-STTAAGGATTCGAATGCAGAGGGCCCTGCTGATTATACTCGAGCCACTCCTTGAACT
pCAGGS-ECGGCTAGCATGGTGGTGGATGATTGCGTCTAGACACATAATGGGTGTTGCG
pCAGGS-MCGGCTAGCATGAGCGATGCGGAAGAATGCGTCTAGACATATATTTATACAGGCGCG
pCAGGS-NCGCGGATCCATGGCCGCACCAGTAGTCCCTACTACCGCTCGAGCGCTGCTGATTCCTGCTTTATCTCA
+ Open protocol
+ Expand
7

Western Blot Analysis of Placental Fatty Acid Transporters

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blot analyses were carried out as described previously [17 (link)]. The total protein of the placenta samples was extracted using a Tissue Protein Extraction Kit (CWBIO, Jiangsu, China), and the concentration of the extracted total protein was determined by a bicinchoninic acid assay (CWBIO, Jiangsu, China). Sodium dodecyl sulphate–polyacrylamide gel electrophoresis and transmembrane experiments were carried out with the Mini-PROTEAN Tube Cell instrument (Bio-Rad, Hercules, CA, USA). The membranes were incubated with primary antibodies, including anti-FATP4 (ProteinTech, Rosemont, IL, USA), anti-CD36 (ProteinTech, Rosemont, IL, USA), anti-FABP5 (ProteinTech, Rosemont, IL, USA), and anti-β-actin primary antibodies (Cell Signaling Technology, Danvers, MA, USA). Thereafter, the membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (Santa Cruz company, Hercules, CA, USA), and immunoreactive bands were visualized using the ECL kit (Beyotime, Shanghai, China) and documented with a chemiluminescence imaging system (UVP, Upland, CA, USA). The results of the densitometric analysis of bands were quantified by Image J 1.45 software (National Institutes of Health, Bethesda, MD, USA). To calculate the relative expression levels of the target proteins, all blots were standardized to β-actin.
+ Open protocol
+ Expand
8

Western Blot Analysis of FOXK1 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RIPA lysis buffer containg protease inhibitor firstly used to lyse the cells or tissues. The total protein was isolated from cell or tissue lysates after centrifugation. The concentration of protein was assessed using a Bradford Protein Assay Kit (Beyotime, China). Then 30 µg protein was separated by an SDS-PAGE and electrotransferred onto a polyvinylidene fluoride (PVDF) membranes (Millipore, Boston, MA, USA) (250 mA, 2 h), blocked with 5% skim milk for 1 h and then incubated with the primary antibodies: anit-FOXK1 (1: 1000 dilution), and anti-β-actin primary antibodies (1: 5000 dilution, Cell Signaling Technology, USA), at 4 °C overnight, followed by incubation with the secondary antibodies for at room temperature for 1 h. Finally, the immune bans were detected using the enhanced chemiluminescence system.
+ Open protocol
+ Expand
9

Western Blot Analysis of HGF, E-cadherin, and Vimentin

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cells were harvested and lysed by RIPA buffer for 30 min at 4°C. 50 µg proteins were loaded into 15% SDS-PAGE for analysis. Rabbit polyclonal anti-HGF, anti-E-cadherin, anti-Vimentin or anti-β-Actin primary antibody (Cell Signaling USA, 1:1000 dilution) was added and the cells were incubated overnight at 4°C. Then, HRP (horseradish peroxidase) conjugate goat-anti-rabbit secondary antibody (Cell Signaling USA, 1:1000 dilution) was added and incubated for 4 h. The bound antibodies were detected using the ECL Plus Western Blotting Detection system (GE Healthcare). β-Actin was used as an internal control.
+ Open protocol
+ Expand
10

Regulation of ATG14 Expression in CRC

Check if the same lab product or an alternative is used in the 5 most similar protocols
To regulate the expression level of ATG14 in CRC cells (HCT116 and SW480), pCMV plasmid was transfected using Lipofect8000 (Thermo Fisher, MA, USA) to induce gene overexpression. pCMV-ATG14-GFP vectors and cDNAs for human ATG14 were obtained from COBIOER (Nanjing, China) and Sino Biological Inc (Beijing, China), respectively. Then, the expression level of ATG14 in normal and ATG-overexpressed HCT116 and SW480 cell lines were determined by western blotting. Anti-ATG14 primary antibody (#5504) and anti-β-actin primary antibody (#3700) were obtained from Cell Signaling Technology Co. (MA, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!