Fastdigest dpni

pMevT4 was generated by PstI digestion of pMevT followed by re-ligation of the backbone using T4 DNA ligase and standard molecular biology methods, excising the metabolic pathway cassette (atoB, ERG13, and tHMGR). pMevT-murI RBS variants were generated by uracil-excision cloning of murI into pMevT with a diversity of eight different murI RBS sequences added via the PCR primers for the cloning fragments (Supplementary Table 11). pMVA1 was similarly generated by uracil-excision cloning of PCR fragments, introducing a constitutive J23100 promoter with a PCR primer (Supplementary Table 11). PCRs were conducted by standard procedures with Phusion U DNA polymerase (Thermo). Uracil-excision cloning was performed by approx. equimolar mixing of the respective purified PCR products (Supplementary Table 11) in a 20 μL reaction, including 2 μL FastDigest buffer (Thermo), 0.75 μL USER enzyme (NEB), and 0.75 μL FastDigest DpnI (Thermo). The reaction incubated for 60 min at 37 °C followed by 20 min at 25 °C, and was subsequently transformed into chemically competent E. coli TOP10 cells.

Full-length human TRPM2 (Transient receptor potential cation channel subfamily M member 2) DNA was purchased from Addgene and eleven mutant constructs (K8R, K55R, K117R, K307R, K314R, K405R, K423R, K596R, K703R, K1218R, and K1544R) were generated using specific primers (shown in Supplementary Table 3), the PrimeSTAR® GXL DNA Polymerase (TAKARA) and FastDigest DpnI (Thermo Fisher Scientific) according to the manufacturer′s instructions. A TRIM21-Flag plasmid was kindly provided by Dr. Wei Xu (Soochow University, Suzhou, China). To construct the shlncTRPM2-AS plasmid, the primers (F: AACGCGGTTACGAGGGCAAATATTCAAGAGATATTTGCCCTCGTAACCGCTTTTTTC, R: TCGAGAAAAAAGCGGTTACGAGGGCAAATATCTCTTGAATATTTGCCCTCGTAACCGCGTT) were inserted into vector pLL3.7, and the presence of the plasmid was confirmed by sequencing and restriction enzyme digest using Hpa I and Xho I.

The amino acid sites selected for mutation are shown in Table 3. KOD FX DNA polymerase (Toyobo) was applied to construct the mutated genes from the wild-type pET28-flaB template via thermal cycling at 95°C for 3 min followed by 25 cycles at 95°C for 15 s, 62°C for 15 s, 68°C for 1 min, and a final extension at 72°C for 5 min. FastDigest DpnI (Thermo Fisher) was added to the PCR product and incubated in a 37°C water bath for 2 h. The mixture was purified using a PCR Clean-Up Kit and transformed into DMT competent cells. Transformants were selected for sequencing using T7 promoter and T7 terminator primers.

The following plasmids were constructed with standard molecular cloning techniques [38 ]. Whole plasmid PCR was used to introduce mutations in the hrp gene by site-directed mutagenesis. The 7 kb fragment was amplified with the respective oligonucleotides to generate single, double, triple and quadruple mutations (Table 7). All oligonucleotides were purchased from Microsynth (Balgach, Switzerland). Each PCR reaction contained 1× Q5 Reaction Buffer, 200 µM dNTP Mix, 200 nM of both forward and reverse primer, 100 ng template vector DNA and 1 U Q5 High-Fidelity DNA Polymerase. The PCR products were purified with the Monarch PCR & DNA Cleanup Kit from New England Biolabs (NEB, Ipswich, MA, USA) and the template plasmid DNA was removed by FastDigest DpnI (Thermo Scientific™, Waltham, MA, USA) digestion. 1 FDU (FastDigest unit, see Abbreviations) of DpnI was added to the cleaned PCR products and incubated overnight at 37 °C. After heat inactivation at 80 °C for 20 min, the plasmids were transformed into BL21 (DE3). All DNA inserts of the recombinant plasmids were verified by DNA sequencing (Microsynth, Balgach, Switzerland).

Saturation mutagenesis was carried
out on residues R9, V11, R52, T77, A78, D81, Y101, and S300. To construct
each library, a mutagenic PCR was made using the pET28b-Hgdh plasmid
as template and four specific primers (three forward mutagenic primers
and one reverse primer, 3). The forward primers were designed to incorporate
the degenerate codons NDT (N = A/T/C/G, D = no C) and VHG (V = no
T, H = no G), and the TGG codon at selected amino acid positions.^{28 (link)} PCR reactions were carried out in a final volume
of 20 μL containing 0.2 mM dNTPs, 0.02 U μL^–1 Phusion HF DNA polymerase, 2.5 ng μL^–1 template,
0.2 μM reverse primer, and 0.2 μM of the three forward
mutagenic primers mixed at a previously reported ratio.^{31 (link)} Reaction conditions were as follows: (i) a hot
start of 98 °C for 2 min; (ii) 24 cycles at 98 °C for 10
s, 62 °C for 1 min, and 72 °C for 1 min 45 s; and (iii)
a final cycle at 72 °C for 10 min. The generated plasmids were
digested with DpnI (FastDigest DpnI, Thermo Scientific, Waltham, MA) at 37 °C for 20 min, dialyzed
against water using an MF-Millipore Membrane Filter (0.025 μm
pore size; Merck Millipore, Billerica, MA), and transformed into E. coli. The plasmids from ten colonies of each library
were sequenced to evaluate the genetic variability at the targeted
residues. Around 90 colonies per library were randomly selected, grown,
and screened.

Following PCR amplification, residual (methylated) DNA template in each PCR reaction was DpnI digested at 37°C for 1 h. Each 110 μL digest reaction consisted of 95 μL PCR product, 11 μL 10x Fast Digest buffer, 1.5 μL Fast Digest DpnI (Thermo Fisher Scientific; Waltham, MA), and 2.5 μL deionized water. DpnI was inactivated at 80°C for 5 min, and DNA purification of each DpnI reaction was conducted with a PCR purification kit (Qiagen; Valencia, CA) according to the manufacturer’s protocol, each purified sample eluted with 50 μL of elution buffer.