First strand cdna synthesis kit

The chloromethane reagent (Servicebio, China) was used to prepare total RNA from hippocampal tissue samples, followed by the use of a First Strand cDNA Synthesis Kit (Servicebio, China) to prepare cDNA. SYBR Green qPCR Master Mix (High ROX) (Servicebio, China) was then used to conduct qPCR analyses using the following primers: IL-1β (F 5′ GCATCCAGCTTCAAATCTCGC 3′; R 5′TGTTCATCTCGGAGCCTGTAGTG 3′), NLRP3 (F 5′TAAGAACTGTCATAGGGTCAAAACG 3′; R5′GTCTGGAAGAACAGGCAACATG 3′), ASC (F 5′ACTATCTGGAGTCGTATGGCTTGG 3′; R 5′ TTCTGTGACCCTGGCAATGAG 3′), caspase-1 (F 5′GGCTGACAAGATCCTGAGGG 3′; R 5′TAGGTCCCGTGCCTTGTCC 3′), TSPO (F 5′GCAGAAACCCTCTTGGCATC 3′; R 5′ AGCGTCCTCTGTGAAACCTCC 3′). Relative mRNA expression was assessed through the 2^−DDCt method, with GAPDH being used for normalization.

According to the manufacturer's protocol, total RNA was isolated from cultured cells or synovial tissue using TRIzol (Invitrogen). Reverse transcription was synthesized via a first strand cDNA synthesis kit (Servicebio). qPCR was performed using a 2xSYBR Green qPCR Master Mix (Servicebio) and operated on ABI Prism 7500 system (Applied Biosystems, Life Technologies). The sequences of primers are listed in Table 1. The expression level of target genes was calculated by a 2^–ΔΔCt method after being normalized to GAPDH expression.

\The transcription factors of IFN-γ, IL-4, FOXP3, and RORγt in lung tissue were detected, and the total RNA from the tissues was extracted by TRIzol (Invitrogen) in accordance with the manufacturer’s instructions. cDNA was synthesized by reverse transcription by using the first-strand cDNA synthesis kit (Servicebio, G3330) in accordance with the manufacturer’s instructions and used for real-time PCR assay performed in 1× SYBR green qPCR master mix (Servicebio, G3320) together with 0.2 mM forward and reverse primers. The amount of mRNA of the indicated genes after normalization of β-actin mRNA. The primers of GAPDH, Foxp3, RORγt, IFN-γ and IL-4 genes were as described as in a previous study (Zhou et al., 2022 (link)).

Firstly, we conducted the total RNA extraction utilizing TRIzol (Ambion, Austin, USA). Then, reverse transcription of total RNA to cDNA was made via First-strand-cDNA-synthesis-kit (Servicebio, Wuhan, China). RT-qPCR was made utilizing the 2xUniversal Blue SYBR Green qPCR Master Mix (Servicebio, Wuhan, China). Specific experimental steps were carried out on the basis of instructions. The primer sequences were showcased in Additional file 1. Internal reference gene was GAPDH. The 2^−ΔΔCt method was utilized to calculate the expression of diagnostic genes [29 (link)]. Levels of expression of diagnostic genes between the control and AR groups were compared by the T test.

Total RNA was isolated from the aforementioned samples and cultured cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA), which was then reverse transcribed into complementary DNA (cDNA) utilizing the first strand cDNA synthesis kit (Servicebio, China). The cDNA was used for qRT-PCR targeting the following genes: NEAT1, 5′-CTCTAGGTTTGGCGCTAAACTCTT-3′ and 5′-CCACCATTACCAACAATACCGACT-3′; miR-128-3p, 5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAAGAGAC-3′ and 5′-ACACTCCAGCTGGGTCACAGTGAACCGGT-3′; ITGA5, 5′-CTCCACAGATAACTTCACCCGA-3′ and 5′-GGCCTTGCCAGAAATAGCTT-3′; GAPDH, 5′-GGAAGCTTGTCATCAATGGAAATC-3′ and 5′-TGATGACCCTTTTGGCTCCCTGATGACCCTTTTGGCTCCC-3′; U6, 5′-CTCGCTTCGGCAGCACACTCGCTTCGGCAGCACA-3′ and 5′-AACGCTTCACGAATTTGCGT-3′. GAPDH was included as an internal amplification control for NEAT1 and ITGA5, while U6 was used as a control for miR-128-3p. Relative quantification was determined via the 2^-∆∆CT method.

Mice in all groups were sacrificed, and the colon tissue from the cecum to the anus was obtained. After removing the tissue used for H&E staining, a total RNA extraction kit was used to extract and isolate RNA from the remaining tissues. After the tissue was fully ground, total RNA was extracted and diluted to an appropriate concentration. The Servicebio^®RT First Strand cDNA Synthesis Kit was used to prepare the reverse transcription system. The reverse transcription program was set as follows: 25°C for 5 minutes, 42°C for 30 minutes, and 85°C for 5 seconds. The 2×SYBR Green qPCR Master Mix (None ROX) was used to perform quantitative fluorescent PCR. The gene sequence was checked from GenBank, and GAPDH was used as the internal reference. The sequences of the forward and reverse primers for GAPDH, IL-1β, and IL-6 are shown in Supplementary Table S1.

Total RNA from cells was extracted by TRIzol reagent (ThermoFisher, America) following the supplier’s instructions. Reverse transcription was conducted with the First Strand cDNA Synthesis Kit (Servicebio, Wuhan, China). PCR was implemented with SYBR Green qPCR Master Mix (Servicebio, Wuhan, China). The conditions for qRT-PCR were as follows: 95°C for 3 min, followed by 40 cycles of 10 s at 95°C, 10 s at 60°C, and 15 s at 70°C, followed by heating from 65°C to 95°C.
The sequences of main primers were as follows: COL14A1 (forward): 5′‐AGTGGGTGAGAAGGCAATGA‐3′, COL14A1 (reverse): 5′‐CTCTCAGGCCTGGAAGTTCA‐3′; TNS1 (forward):5’-TCAAGTGGAAGAACTTGTTTGCTT-3’, TNS1 (reverse): 5′‐CACGACAATATAGTGGAGGCACA‐3′; NUSAP1 (forward): 5′-AGCCCATCAATAAGGGAGGG-3′, NUSAP1 (reverse): 5′‐ACCTGACACCCGTTTTAGCTG‐3′; YWHAE (forward): 5′‐GCTGGATCCATGGATGATCGAGAGGATCTG‐3′, YWHAE (reverse): 5′‐GCTGAATTCTCACTGATTTTCGTCTTCCAC‐3′; GAPDH (forward): 5′‐CACCATTGGCAATGAGCGGTTC‐3′, GAPDH (reverse): 5′‐AGGTCTTTGCGGATGTCCACGT‐3′; GAPDH was utilized as an endogenous control.