Ssoadvanced sybr green mix

Total RNA from frozen tissues (liver, cortex, kidney) was isolated using TRIzol^® Reagent per the manufacturer’s instructions (Thermo Fisher; Waltham, MA) and quantified via Qubit assay as we have described previously [30 (link),33 (link),71 (link),72 (link),73 (link)]. First-strand complementary DNA (cDNA) was synthesized with random primers using Bio-Rad iScript cDNA Synthesis Kit. All qPCR reactions were then carried out using Bio-Rad SsoAdvanced SYBR Green mix on a Bio-Rad CFX384 qRT-PCR Machine. Gene expression was carried out in the liver, kidney, and cortex for IL6 (For—5′ AGTTGCCTTCTTGGGACTGA and Rev—5′ TCCACGATTTCCCAGAGAAC) TNF-α (For—5′ ATGAGAAGTTCCCAAATGGC and Rev—CTCCACTTGGTGGTTTGCTA) and IL-1β (For—5′ GCCCATCCTCTGTGACTCAT and Rev—5′ AGGCCACAGGTATTTTGTCG), and all data were normalized to Peptidylprolyl isomerase A (PPIA; For- 5′ GCGTCTSCTTCGAGCTGTT and Rev—5′ RAAGTCACCACCCTGGCA) using the ∆∆Ct method.

Total RNA from frozen tissues was isolated using the Trizol procedure as described previously (36 (link)). In brief, first-strand complementary DNA (cDNA) was synthesized with random primers and total RNA as a template using Biorad iScript cDNA Synthesis Kit. All qPCR reactions were carried out using Biorad Sso Advanced SYBR Green mix on a Biorad CFX384 qRT-PCR Machine. All data were then normalized to the housekeeping gene, 18S, using the delta delta Ct method. Primer sequences are provided in Supplementary Table 1.

cDNA was generated by reverse transcription using the HiFlex miScript II RT Kit (Qiagen, MD, USA, cat. no. 218160) from 1 μg of DNase-treated RNA following the manufacturer’s protocol. After diluting the cDNA (1/10), qPCR was performed using the SSo Advanced SYBR Green mix (Bio-Rad, CA, USA, cat. no. 1725271) in 0.1 ml MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystem, cat. no. 4346907).
The final concentration of the primers (Integrated DNA Technologies, Inc.) used in RT-qPCR was 500 nM and their sequence are listed in S2 Table. The primers were designed with Primer-BLAST tools and recommendations [118 (link)]. Primers were chosen to allow specific amplification of the target messengers (span exon-exon junction). Temperature gradient tests were performed to determine the best annealing temperature for each primer pair.
Unless otherwise specified, qPCR reactions were performed using the StepOne Real-Time PCR System (cat. no. 4376357). Unless otherwise specified, all data obtained (from StepOne Software) were normalized with reference genes (ACTB or GAPDH) and reported to the controls. The relative quantitation was calculated using the ΔΔCt method [119 (link)].

Bacterial density was estimated by real-time quantitative polymerase chain reaction (q-PCR) of ribosomal DNA. This approach is now considered as a valuable, accurate and culture-independent method (Smith and Osborn, 2009 (link)). Amplification was carried out with a CFX96 Touch™ Real-Time PCR Detection System (Biorad, Hercules, CA, USA) using SYBR Green as detection system. For amplification, we performed PCR in 10 μL of reaction mixture composed by 0.5 μM for each of the primers 341 F (5′ CCT ACG GGA GGC AGC AG 3′) and 515R (5′ ATT ACC GCG GCT GCT GGC A 3′), 5 μL of SsoAdvanced SYBR Green mix (Biorad, USA), 2.5 ng of template DNA and DNAse-RNAse free water. The cycling program included: 10 min of incubation at 98°C, followed by 39 cycles of 98°C for 5 s and 60°C for 30 s. Amplification specificity was studied using melting curve analysis of the PCR products performed by ramping the temperature from 55 to 95°C (+0.5°C every 5 s). Standard tubes containing DNA copies numbers ranging from 10³ to 10⁸ were used for calibration.

The total RNA from the frozen tissues was isolated using the TRIzol® Reagent per the manufacturer’s instructions (Life Technologies). First-strand complementary DNA (cDNA) was synthesized with random primers using Bio-Rad iScript cDNA Synthesis Kit. All qPCR reactions were carried out using Bio-Rad Sso Advanced SYBR Green mix on a Bio-Rad CFX384 qRT-PCR Machine. Target genes included GRIN2B, TNFα, CDKN1A, IL1β, NFκB/p65, and CCL2, and all data were normalized to Actb.