The largest database of trusted experimental protocols

Mirna inhibitor

Manufactured by Thermo Fisher Scientific
Sourced in United States, China

MiRNA inhibitors are laboratory reagents designed to target and inhibit the activity of microRNA (miRNA) molecules. MiRNA inhibitors are used in research applications to study the biological functions and regulatory roles of specific miRNAs in cellular processes.

Automatically generated - may contain errors

45 protocols using mirna inhibitor

1

Studying CASC2 Effects on Cell Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
To study the effects of CASC2 on cell activity, plasmid complementary DNA lncRNA-CASC2 cDNA was constructed by introducing the cDNA sequence of CASC2 into the pcDNA3.1 expression vector (Invitrogen, Shanghai, China). The miRNA mimics, miRNA inhibitors and siRNAs for the knockdown of CASC2 expression were from GenePharma (Shanghai, China). For the transfection of the pcDNA-CASC2, miRNA mimics, miRNA inhibitors, and siRNAs, CRC cell lines (2 × 105) were transfected with miRNA mimics, miRNA inhibitors or siRNAs at a final concentration of 25 nmol/l using Lipofectamine 2000 Reagent (Life Technologies). The above-mentioned cells were transfected with pcDNA-CASC2 constructs at a final concentration of 1 μg/μl according the protocol recommended by the manufacturer. After transfection for 48 h, total RNA from the harvested cells was isolated with Trizol reagent (Invitrogen, Carlsbad, CA, USA). The empty pcDNA3.1 vector and scramble sequence of miRNA mimics, miRNA inhibitors or siRNAs were used as the negative controls (NC).
+ Open protocol
+ Expand
2

Transfection of Liver Cell Lines with miR-483

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepaRG, HepG2, SK-Hep1, Hep3B cells, and human hepatocytes were grown in 6-well plates (1 × 105 cells/wells) for 24 h before transfection. Cells were transfected with mirVana miRNA-483-5p mimic (miR-483) (AAGACGGGAGGAAAGAAGGGAG; Cat #4464066), mirVana miRNA-483-5p inhibitor (miR-483 Inh.) (AAGACGGGAGGAAAGAAGGGAG; Cat #4464084) or mirVana miRNA Mimic Negative Control #1 (NC) (Cat #4464058). All mirVana miRNA mimics, negative control, and miRNA inhibitor were obtained from Ambion (Austin, TX). HCC cells and hepatocytes were transfected with 100 nM of negative control (NC) or 25–100 nM of miR-483 mimic or miR-483 inhibitor using the Lipofectamine-2000 reagent (Invitrogen, Waltham, MA, USA). Cells were harvested 30 h after transfection. The expression of miR-483 target genes was analyzed by RT/qPCR, and protein expression was assessed by immunoblotting.
+ Open protocol
+ Expand
3

Modulating miR-99b Expression in Prostate Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
PC3 and LNCaP cells were grown in 6-well plates (1 × 10 5 cells/ well) for 24 h before transfection. Cells were transfected with mirVana miRNA, negative control #1 (NC) (Cat # 4464058), mirVana miRNA-99b-5p mimic (CACCCGUAGAACCGACCUUGCG) (Cat # 4464066) and mirVana miRNA-99b-5p inhibitor (miR-99b Inh.) (CACCCGUAGAACCGACCUUGCG) (Cat # 4464084) separately. All mirVana miRNA, negative control, miRNA mimic, and miRNA inhibitor were obtained from Ambion (Austin TX). PCa cells were transfected with 100 nM of negative control (NC) or miR-99b mimic or miR-99b inhibitor using Lipofectamine-2000 reagent (Invitrogen). After transfection for 30 h, cells were harvested and the expression of miR-99b or its targets were analyzed by RT/qPCR or immunoblotting.
+ Open protocol
+ Expand
4

Cell Proliferation Assay with siRNA and Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells (2 × 104/well) were incubated in 70% MEM with 10% FBS, 30% Opti-MEM with 15 pM siRNA, or miRNA inhibitor (Applied Biosystems) and 0.25 μl/well of Lipofectamine (Invitrogen) in 96-well plates. For the experiments using inhibitors, cells were treated with either SJ001 (cambogin, 5 μM) [65 (link)] or 10058-F4 (an inhibitor that disrupts the c-MYC-Max interaction) [45 (link)–47 (link)] (Calbiochem) at various concentration as indicated in the figures. At 48 h post-treatment, cell proliferation rates were determined using a MTS assay (Promega).
+ Open protocol
+ Expand
5

Inhibiting miRNA-455-3p in PHCjEs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The miRNA inhibitor and the control for miRNA-455-3p were purchased from Applied Biosystems. The inhibitor and the negative control were mixed with Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) and added for 24 h to PHCjEs at 80% confluence.
+ Open protocol
+ Expand
6

Modulating miR-493 and LINC00173 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
An miR-493 mimic, negative control (NC) miRNA mimic (miR-NC), miR-493 inhibitor, and NC inhibitor were acquired from GenePharma Technology (Shanghai, China). Small interfering RNAs (siRNA) specific to LINC00173 (si-LINC00173) and NC siRNA (si-NC) were synthesized by RiboBio (Guangzhou, China). IRS4-overexpressing plasmid pcDNA3.1-IRS4 was bought from Sangon Biotech (Shanghai, China). Cells were grown up to 60% confluence and transfected with the miRNA mimic (100 pmol), miRNA inhibitor (100 pmol), siRNA (100 pmol) or plasmid (4 µg) using Lipofectamine 2000® (Invitrogen; Thermo Fisher Scientific).
+ Open protocol
+ Expand
7

Chondrocyte Transfection and OA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chondrocytes collected from healthy adults (402-05A, Sigma-Aldrich) and from OA patients (402OA-05A, Sigma-Aldrich) were included in this study to match the OA patients and healthy controls included in this study. Cell culture medium was composed of 10% FBS and 90% chondrocyte growth medium (PromoCell). Cell culture conditions were 37 °C, 95% humidity and 5% CO2. Cells were collected at about 80% confluence to perform transfections. PcDNA 3.1 was used to construct the expression vector of SNHG9 (NCBI Accession: NR_003142.2). Negative control (NC) miRNA (5′-CUGUACGUGCUAGUGCGUGGA-3′) and miR-34a mimic (5′-UGGCAGUGUCUUAGCUGGUUGU-3′) were obtained from Sigma-Aldrich (USA). MiR-34a inhibitor (Cat # HMI0508-5NMOL) and miRNA inhibitor NC (Cat # NCSTUD001) were also purchased from Sigma-Aldrich. Lipofectamine 2000 (Invitrogen) was used to transfect 106 chondrocytes (two types) with 40 nM miR-34a mimic, 40 nM miRNA inhibitor, or 10 nM SNHG9 expression vector following the manufacturer’s instructions. The transfection mixture was incubated for 6 h. Transfection with empty vector, NC inhibitor or NC miRNA was used as the NC group. Untransfected cells were used as the control (C) group. Following experiments were performed at 48 h post-transfection.
+ Open protocol
+ Expand
8

RNA Oligo Transfection and PRRSV Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA oligos including miRNA inhibitor, miRNA mimic, and siRNA were synthesized by Genepharma (Suzhou, China). The RNA oligo sequences are listed in Table S1. The miRNA mimic (at a concentration of 50 nM), miRNA inhibitor (50 nM), siRNA (100 nM), and the corresponding negative control were transfected into target cells for 24 h using lipofectamine RNAiMAX reagent (Invitrogen, USA) according to the manufacturer’s instructions.
After all the different indicated treatments, cell monolayers were inoculated with HP-PRRSV HuN4 at an MOI of 0.1 unless otherwise stated. After 60 min of incubation, cell monolayers were washed and then further incubated in fresh culture media for an additional 24 h or indicated time points. The cells and supernatants were then collected for qPCR and virus titer determination separately.
+ Open protocol
+ Expand
9

MiR-494 Modulation in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MiR-494 mimic, miR-494 inhibitor and the corresponding negative control (mimics NC and inhibitor NC) were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). The miRNA mimics, miRNA inhibitor, and the negative control miRNA oligonucleotides were transfected into the HEK293T cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions.
+ Open protocol
+ Expand
10

Efficient Gene Regulation in BMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The miRNA mimics, miRNA inhibitors, and siRNAs (GenePharma Co., China) were used for gene overexpression or knockdown. The siRNA sequences are shown in Supplementary Table 1. Before transfection, the BMSCs culture media was removed, and fresh serum-free media (Gibco) was added. For miRNA mimic, miRNA inhibitor, siRNA, or negative control transfection, Lipofectamine 2000 transfection agent (Invitrogen, USA) was used, following the manufacturer’s instructions. Lentivirus transfection [negative control (Vector), WTAP overexpression lentivirus (OE-WTAP), negative control (shNC), and WTAP-knockdown lentivirus (shWTAP)] was performed at a 30–50% cell density. The culture medium was replaced 6–12 h after transfection and every 3 days until the cells reached 80–90% confluency. After 72 h of transfection, stably transfected cell lines were selected using 2 μg/mL puromycin.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!