Lactalbumin

Manufactured by Merck Group

Sourced in United States

Lactalbumin is a milk protein that can be used as a component in various laboratory applications. It is a naturally occurring protein found in milk.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

α-lactalbumin from bovine milk Alpha-lactalbumin α-lactalbumin Holo α-Lactalbumin Bovine α-lactalbumin Lactalbumin hydrolysate α-lactalbumin (aLac)

10 protocols using lactalbumin

Myogel Transwell Invasion Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the Myogel Transwell invasion assay, a mix of Myogel with 0.8 mg/ml rat collagen and 2.4 mg/ml Myogel was prepared. A 50 μl of this Myogel mix was used to coat 24-well Transwell plate, followed by 30 min to 1 h incubation at + 37 °C for the gel to develop. A volume of 500 μl of normal cell culture media was added to the bottom of the well. Total of 70,000 cells in 200 μl lactalbumin media were added on top of Myogel. In lactalbumin media, the FBS was replaced by 0.5% lactalbumin (Sigma-Aldrich).
The cells were allowed to grow and invade for 72 h and then fixated with 4% formaldehyde for 1 h and washed with PBS. Invaded cells were stained with 1% Toluidine blue + 1% Borax at room temperature. After staining, the cells were washed several times with distilled water and non-invaded cell from the upper chamber were carefully removed with wet cotton swabs. Staining was eluted with 1% Sodium Dodecyl Sulfate (SDS) and transferred to 96-well plate. The absorbance was measured at 650 nm with Synergy™ HT (BioTek Instruments, Inc., Winooski, Vermont, USA) according to manufacturer’s instructions. The results represent an average of three cultures, performed in triplicate.

Tuominen H., Al-Samadi A., Salo T, & Rautava J. (2020). Human myoma tissue-based extracellular matrix models for testing the effects of irradiation on the HPV positive cells. Virology Journal, 17, 87.

+ Open protocol

+ Expand

Propagation and Maintenance of Schistosoma mansoni

Check if the same lab product or an alternative is used in the 5 most similar protocols

The S. mansoni LE strain is maintained throughout passages between hamsters and Biomphalaria glabrata hosts, in the “Lobato Paraense” snail facility at the René Rachou Institute—FIOCRUZ.
Schistosomula were obtained by mechanical transformation of cercariae as previously described (21 (link)) and cultured in Glasgow Minimum Essential Medium (Sigma-Aldrich, Germany) supplemented with 0,2 μM triiodothyronine (Sigma-Aldrich, Germany); 0.1% glucose; 0.1% lactalbumin (Sigma-Aldrich, Germany); 20 mM HEPES; 0.5% MEM vitamin solution (Gibco, USA); 5% Schneider's Insect Medium (Sigma-Aldrich, Germany); 0.5 μM Hypoxanthine (Sigma-Aldrich, Germany), 1 μM hydrocortisone (Sigma-Aldrich, Germany), 1% Penicillin/Streptomycin (Gibco, USA) and 2% heat-inactivated Fetal Bovine Serum (Gibco, USA).
Approximately 300 cercariae were subcutaneously inoculated in Golden hamsters (Mesocricetus auratus) for adult worm recovery. After 40 days, the hamsters were euthanized by overdose and perfused with a saline solution containing heparin (2,500 U/L) (22 (link)). After perfusion, males and females worms were manually separated when necessary. Adult worms were then cultured in RPMI 1640 medium (Gibco, USA) supplemented with 10% heat-inactivated Fetal Bovine Serum (Gibco, USA) and 2% Penicillin/Streptomycin (Gibco, USA).

Avelar L.D., Gava S.G., Neves R.H., Silva M.C., Araújo N., Tavares N.C., Khal A.E., Mattos A.C., Machado-Silva J.R., Oliveira G, & Mourão M.D. (2019). Smp38 MAP Kinase Regulation in Schistosoma mansoni: Roles in Survival, Oviposition, and Protection Against Oxidative Stress. Frontiers in Immunology, 10, 21.

+ Open protocol

+ Expand

Spodoptera frugiperda Cell Line Maintenance

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Spodoptera frugiperda cell line, Sf9, was maintained at 27°C in Grace medium (Invitrogen, USA) supplemented with 10% heat-inactivated fetal bovine serum (56°C, 30 min) (Wisent, Inc., Canada), 1X Yeastolate (Invitrogen, USA), 1X Lactalbumin (SIGMA, USA), and 1X Antibiotic-antimycotic (Invitrogen, USA) according to standard methods. For suspension cultures, pluronic acid F-68 at a final concentration of 0.1% was added and the cells were sub-cultured every 2 to 3 days. The Bac-N-blue system (Invitrogen, USA) was used for the construction of the recombinant baculovirus (see below). The WT and recombinant AcMNPVs used in the present study were propagated in Sf9 cells.

Sampieri A., Luz-Madrigal A., Zepeda J, & Vaca L. (2015). Identification of fragments from Autographa Californica polyhedrin protein essential for self-aggregation and exogenous protein incorporation. BMC Biochemistry, 16, 5.

+ Open protocol

+ Expand

Schistosomula Culture and RNAi Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Schistosomula cultures (∼500,000 worms/condition) were maintained in bottles with 10 mL of Glasgow Minimum Essential Medium (GMEM) (Sigma-Aldrich) supplemented with 0.2 µM triiodothyronine (Sigma-Aldrich); 0.1% glucose; 0.1% lactalbumin (Sigma-Aldrich); 20 mM HEPES; 0.5% MEM vitamin solution (Gibco, Thermo Fisher Scientific); 5% Schneider’s Insect Medium (Sigma-Aldrich); 0.5 µM Hypoxanthine (Sigma-Aldrich), 1 µM hydrocortisone (Sigma-Aldrich), 1% Penicillin/Streptomycin (Gibco, Thermo Fisher Scientific), and 2% heat-inactivated Fetal Bovine Serum (Gibco, Thermo Fisher Scientific). SmJNK dsRNA was added shortly after schistosomula transformation to a final concentration of 100 nM. Cultures were kept in a Bio-Oxygen Demand incubator (B.O.D.) at 37°C, 5% CO₂, and 95% humidity. Two independent biological replicates were performed. Data were analyzed using unpaired t-test with Welch’s correction.

Gava S.G., Tavares N.C., Falcone F.H., Oliveira G, & Mourão M.M. (2019). Profiling Transcriptional Regulation and Functional Roles of Schistosoma mansoni c-Jun N-Terminal Kinase. Frontiers in Genetics, 10, 1036.

+ Open protocol

+ Expand

Recombinant Baculovirus and Nanoparticle Production

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Spodoptera frugiperda cell line, Sf9 (ATCC^®, USA cat. no. CRL-1711), was used for the propagation and titration of recombinant baculoviruses, later they were also used for the expression of PH_(1-110)GFP nanoparticles (NPs) (19 (link)). Cells were maintained in Grace medium (Thermo Fisher, USA, cat. no. 11300-027) supplemented with 10% inactivated fetal bovine serum (FBS) (Biowest, France, cat. no. S1650-500), lactalbumin (Sigma -Aldrich, USA, cat. no. 19010), yeastolate (Thermo Fisher, USA, cat. no. 292805), antibiotic-antimycotic (Thermo Fisher, USA, cat. no. 15240-062), and 0.1% pluronic acid F- 68 (Sigma-Aldrich, USA, cat. no. P1300) at 27°C under stirring.
For the amplification of the plasmids pET-His-GFP and pET-His-PH_(1-110), Escherichia coli Top10 cells were used, and the expression of recombinant proteins was carried out with E. coli BL21(DE3) cells. For the transformation and growth of the bacterial strains, a standard protocol was followed (24 (link)). Selection of successfully transformed bacteria was performed on LB (Luria Bertani) agar plates (Sigma-Aldrich, USA, cat. no. L3022-1KG) with kanamycin (50 μg/mL). Bacterial colonies were picked from agar and grown in LB medium (Sigma-Aldrich, USA, cat. no. A7002-250G). Sequencing was performed to assess the presence of the genes of interest.

Cruz-Resendiz A., Acero G., Sampieri A., Gevorkian G., Salvador C., Escobar L., Rosendo-Pineda M.J., Medeiros M, & Vaca L. (2022). An ambient-temperature stable nanoparticle-based vaccine for nasal application that confers long-lasting immunogenicity to carried antigens. Frontiers in Immunology, 13, 1057499.

+ Open protocol

+ Expand

Parasite Culture Reagents and Primers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following reagents were used for parasite culture, Glasgow Minimum Essential Medium (GMEM), triiodothyronine, lactalbumin, HEPES, MEM vitamin solution, Schneider’s Insect Medium, hypoxanthine, and hydrocortisone were purchased from Sigma-Aldrich. Penicillin/streptomycin, RPMI 1640 medium, and Fetal Bovine Serum (FBS) were from Gibco; glucose from VETEC; TRIzol Reagent from Invitrogen.
All primers were purchased from IDT, Smcarm1-dsRNA_F: taatacgactcactatagggCATGGCATGGATCTAACTGC, Smcarm1-dsRNA_R: taatacgactcactatagggTGTTGTTGTTGCTGTTGTGC, Smcarm1-qPCR_F: TGCTGTTGAAGCATCTAATATGG, Smcarm1-qPCR_R: ATAATGACATCCACTGGTTCG; SmcoxI (Smp_900000) SmcoxI-qPCR_F: TACGGTTGGTGGTGTCACAG, SmcoxI-qPCR_R: ACGGCCATCACCATACTAGC; GFP-dsRNA_F: taatacgactcactatagggTCTTCAAGTCCGCCATG, GFP-dsRNA_R: taatacgactcactatagggTGCTCAGGTAGTGGTTGTC. The sequences in lowercase correspond to the T7 promoter sequence added to the 5′-end in primers designed for dsRNA synthesis.

Coelho F.S., Gava S.G., Andrade L.F., Geraldo J.A., Tavares N.C., Lunkes F.M., Neves R.H., Machado-Silva J.R., Pierce R.J., Oliveira G, & Mourão M.M. (2023). Schistosoma mansoni coactivator associated arginine methyltransferase 1 (SmCARM1) effect on parasite reproduction. Frontiers in Microbiology, 14, 1079855.

+ Open protocol

+ Expand

Comprehensive Reagent Catalog for Diverse Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

The catalog number of reagents used in this work is as follows. Promega: GoTaq Green Master Mix (M7122), Wizard SV Gel and PCR Clean-Up System (A9282), pGEM-T Easy vector (A1360), PureYield Plasmid Miniprep System (A1222), T7 RiboMAX Express RNAi System (P1700), SV Total RNA Isolation System (Z3105), and ImProm-II Reverse Transcription System (A3800). Sigma-Aldrich: GMEM (G6148), lactalbumin (L7252), HEPES (H3375), triiodothyronine (709611), hypoxanthine (H9636), hydrocortisone (H0888), Schneider’s Insect Medium (S0146), propidium iodide (P4170), Dulbecco’s modified Eagle’s medium (D5030), and carmine (C1022). Gibco, Thermo Fisher Scientific: fetal bovine serum (16000044), MEM vitamin solution (11120052), penicillin/streptomycin (15070063), and gentamicin (15710064). Applied Biosystems: SYBR Green PCR Master Mix (4309155). Ambion: Turbo DNase (AM2238). Invitrogen: Qubit RNA HS Assay Kit (Q32855). Syntec: xylazine hydrochloride (v-007) and ketamine hydrochloride (v-001). Cristália: sodium thiopental (22.1535). Renylab: hematoxylin (0012). Sciavicco: eosin (EA36). Vetec: Glucose (V000221. Synth: Canadian balsam (00B1001.08.BJ). Merck Millipore: ethanol (64-17-5), glacial acid acetic (64-19-7), and HCl (109057). Dinâmica: formaldehyde (P.10.0504.000.000) and methyl salicylate (60READIN016786).

Tavares N.C., Gava S.G., Torres G.P., de Paiva C.Ê., Moreira B.P., Lunkes F.M., Montresor L.C., Caldeira R.L, & Mourão M.M. (2020). Schistosoma mansoni FES Tyrosine Kinase Involvement in the Mammalian Schistosomiasis Outcome and Miracidia Infection Capability in Biomphalaria glabrata. Frontiers in Microbiology, 11, 963.

+ Open protocol

+ Expand

Cell Culture of Equine and Mammalian Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

(i) RK13 cells. Rabbit kidney (RK13) cells were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in minimal essential medium (MEM) (Thermo Fisher Scientific) with 10% fetal calf serum (FCS; Thermo Fisher Scientific) and antibiotics.
(ii) MDCK cells. Madin-Darby canine kidney (MDCK) epithelial cells (ATCC) were maintained in MEM containing 1 mg/ml lactalbumin (Sigma-Aldrich) and antibiotics.
(iii) EREC. Primary equine respiratory epithelial cells (EREC) were isolated and cultured as described previously (26 (link), 55 (link)).
(iv) Equine monocytes, equine T lymphocytes, and equine polymorphonuclear cells. Equine peripheral blood mononuclear cells (PBMC) and polymorphonuclear (PMN) cells were isolated as described previously (47 (link), 56 (link), 57 (link)).

Van Cleemput J., Poelaert K.C., Laval K., Vanderheijden N., Dhaenens M., Daled S., Boyen F., Pasmans F, & Nauwynck H.J. (2020). An Alphaherpesvirus Exploits Antimicrobial β-Defensins To Initiate Respiratory Tract Infection. Journal of Virology, 94(8), e01676-19.

+ Open protocol

+ Expand

Zymography of Cell Secreted MMPs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Subconfluent cultures of HaCaT, HGF, IHGK, SCC-25 and HSC-3 (control and shMMP9) and MDA-MB-231 cells were cultured in Opti-MEM (Gibco) and control and arrHSC-3 in 1% lactalbumin (Sigma-Aldrich) medium for 24 h and media were collected for zymography. In some cases, the cell layers were scratched by pipette tip and media were collected after 24 h and 48 h with their unscratched controls. Zymography was performed as previously described ( 21) using either the same media protein amount or sample volume. The cells were lysed for zymography as described in the 'Western blot' section.

Väyrynen O., Åström P., Nyberg P., Alahuhta I., Pirilä E., Vilen S.T., Aikio M., Heljasvaara R., Risteli M., Sutinen M, & Salo T. (2019). Matrix metalloproteinase 9 inhibits the motility of highly aggressive HSC-3 oral squamous cell carcinoma cells. Experimental cell research, 376(1).

+ Open protocol

+ Expand

Protein Structural Analysis by VCD

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hen-egg-white and human lysozyme, human serum albumin, myoglobin, lactalbumin, insulin and concanavalin A (all from Sigma-Aldrich) were dissolved to a concentration of 300 mg mL À1 . By default, MilliQ water was used; concanavalin A was dissolved in 100 mM phosphate buffer, pH = 6, and for insulin the pH was adjusted to 2.5 with HCl. VCD measurements were performed using a BioTools ChiralIR-2X instrument and the samples were placed in a demountable custom made (by Meopta, Inc.) CaF 2 cell devoid of any spacer 23 as it would be problematic for the 8 mm path length. High protein concentration and thin path length are needed to collect data in a wide spectral range of B1200-2000 cm À1 , which would be otherwise partially obscured by water absorption. Additional measurements were carried out in a BaF 2 cell using both D 2 Oand H 2 O-based solvents, with 50 and 15 mm spacers and protein concentrations of 30 and 150-250 mg mL À1 , respectively. This reduced spectral noise but narrowed the usable wavenumber interval. Each spectrum was accumulated for 16 hours at 8 cm À1 resolution. Absorption (IR) and VCD spectra of pure solvents were subtracted to correct for instrumental artifacts.

Kessler J., Andrushchenko V., Kapitán J, & Bouř P. (2018). Insight into vibrational circular dichroism of proteins by density functional modeling. Physical chemistry chemical physics : PCCP, 20(7).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!