For further analysis of the specific aptamer library a quantitative PCR (qPCR) was performed with the eluates of the SELEX rounds six to eight using SYBR green dye (final concentration 0.5×) (Sigma-Aldrich, St. Louis, MO, USA) and qTOWER3G touch (Analytik Jena GmbH, Jena, Germany). A standard curve in the range of 0.01–1 ng was prepared with a synthetic aptamer library. Afterwards, a melting curve analysis and the determination of the Ct value could be conducted from which the DNA quantity in the sample could be calculated.
Sybr green dye
Manufactured by Merck Group
Sourced in United States
SYBR Green dye is a fluorescent dye used in molecular biology laboratories. It binds to double-stranded DNA and emits a green fluorescent signal upon excitation, allowing for the detection and quantification of DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Dnase 1 amplification grade, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Qtower3g touch, by Analytik Jena (1 mentions)
Rabbit anti hbcag polyclonal antibody, by Agilent Technologies (1 mentions)
Dako envision detection system, by Agilent Technologies (1 mentions)
Itaq dna polymerase, by Bio-Rad (1 mentions)
Supersciptii, by Thermo Fisher Scientific (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Pcr buffer, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Fluorescence microscope, by Nikon (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
8 protocols using sybr green dye
1
Quantitative Analysis of Aptamer Library
2
Hepatitis B Virus Serological and Viral Load Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The serum of mice was collected and diluted 1:10 with PBS. HBsAg, HBsAb, HBeAg, HBeAb, and HBcAb were detected using an ELISA kit (Kehua Bio-engineering Co. Ltd., Shanghai, China), per the manufacturer's instructions. The viral load was quantified by real-time polymerase chain reaction (PCR) using SYBR Green dye (Sigma-Aldrich, St. Louis, MO, USA) as described previously (Wang et al., 2014b (link)). HBcAg in the liver tissue was detected by immunohistochemistry. The liver tissue was collected, embedded in paraffin, and sectioned. The sections were stained with rabbit anti- HBcAg polyclonal antibody (Dako, Japan) and visualized using the DAKO EnVision™ Detection Systems (Dako, Japan), according to the manufacturer's instructions.
3
Real-time RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time RT-PCR was carried out as described previously16 (link). Briefly, Total RNA was isolated from frozen preoptic tissue samples, or lysated primer cultures. The concentration of RNA was adjusted to 2 µg/µL, and it was treated with Amplification Grade DNase I (Invitrogen). Then, cDNA was synthesized using SupersciptII (Invitrogen) as suggested in the kit protocol. The cDNA was subsequently diluted (10x), and 2.5 µL of the resulting cDNA was used as template in PCR reactions using SYBR Green dye (Sigma, St Louis, MO, USA). The PCR reactions were performed with iTaq DNA polymerase (Bio-Rad Laboratories, Hercules, CA, USA) and GAPDH was used as housekeeping gene. The primers were: ACAGCCAGCGCTACAAAGTT and GCGGTATCTACTGGCTCTGC for IGFBP-3, and GCTACCGAGAGGACAGCATC and GCACCATAAGCCTTCAGCTC for TH, and TGCCACTCAGAAGACTGTGG and GTCCTCAGTGTAGCCCAGGA for GAPDH. Cycle threshold (Ct) values were obtained from the linear region of baseline adjusted amplification curves. The GAPDH related values were calculated using the following formula: log(Ct(GAPDH) − Ct(IGFBP3 or TH)). Statistical analyses were performed by unpaired t-test for comparisons of the two different groups.
4
Validating Illumina Sequencing with RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate Illumina sequencing data, 36 differentially expressed genes were selected for real time RT-PCR analysis, using new RNA isolated from four biological replicate stem samples. RNA isolation was done according to a modified CTAB method described by Chen et al. (2012) [20] . Primers were designed using Primer 3 software to amplify 150–250 bp fragments for 36 transcripts selected from the RNA-Seq libraries as potential candidate genes (Table S1 ). Real time expression assays were performed with SYBR Green dye (Sigma-Aldrich) on the ABI 7500 Real-Time PCR System (Applied Biosystems). 18S ribosomal RNA (AB120309.1, C. sinensis) was utilized as the house-keeping gene. PCR reaction efficiency was calculated for each primer set using serial dilutions of a cDNA template and plotting Ct values against the log of the template concentrations. The slope of the line was subsequently used to calculate the amplification efficiency (E) according to: E = 10(–1/slope), which was used in the calculation of relative normalized expression in QBase [21] .
5
Quantification of pNL4-3 by Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Serial dilutions of pNL4-3 mixed with pUC19 were quantified by real-time PCR using primers nF6026 and nR6373. Each 25 µl real-time PCR reaction contained 5 µl DNA, 1 × PCR buffer (Invitrogen), 5 mM MgCl2, 0.2 mM dNTPs, 0.2 µM of each primer, SYBR Green dye diluted 1:2500 (Sigma), and 1.25 U Platinum Taq DNA polymerase (Thermo Fisher Scientific). PCR conditions consisted in one cycle at 98˚C for 30 s and 35 cycles of 98 °C for 10 s, 60 °C for 10 s, and 72 °C for 10 s. Real-time PCR amplification, data acquisition, and analysis were performed using the ABI, StepOnePlus Real-Time PCR System (Applied Biosystems, Walthman, MA).
6
DNA Damage Assessment of QC, Talazoparib, and Combination
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA damaging potentialities of QC, Talazoparib, and QC + Talazoparib were checked by performing the alkaline comet assay. Briefly, 4 × 10 4 OM-CSCs were added in a 6 well plate. After 24 h, the cells were exposed to the QC, Talazoparib, and their combination at the aforementioned concentrations for 48 hours. The cells were then trypsinzed and collected, following which they were resuspended in chilled 1X PBS. Next, the comet assay was carried out as mentioned in the previous protocol [39] . SYBR ® green dye (Sigma-Aldrich) was used to stain the comet slides. The migration of DNA was observed at 40X magnification through a fluorescence microscope (Nikon, Japan). TriTek Comet Score™ software (Tritek Corporation, VA, USA) was used to analyze the comet length, which was plotted as arbitrary comet length vs various treatment conditions.
7
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from the tissue samples was isolated using TRIzol reagent (Invitrogen; Thermo Fisher Scientific. Inc.). cDNA synthesis for mRNA was carried out using a PrimeScript RT Reagent Kit (Takara, Shiga, Japan). After the RT reaction, 2 μL of cDNA was used for subsequent qPCR with SYBR Green dye (Sigma-Aldrich, USA), conducted with a 7500 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The PCR conditions were: 40 cycles of 95 °C for 30 s, 60 °C for 34 s, and 72 °C for 30 s. All of the primer sequences are listed in Additional file 4 (Table S1). The relative expression levels of the candidate genes were analyzed using the 2−ΔΔCt method.
8
Quantitative PCR of Cryab in Maternal mPFC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT-PCR analysis, mPFC dissected from 8 mothers with litters and 8 pupdeprived control rats were used. A quantitative real-time RT-PCR analysis was performed for Cryab in the maternal and pup-deprived mPFC samples as described previously [36] . The total RNA was isolated from the microdissected mPFC using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. After diluting RNA to 2 g/l, it was treated with Amplification Grade DNase I (Invitrogen) and cDNA was synthesized with a Superscript II reverse transcriptase kit (Invitrogen), according to the manufacturer's instructions. After a 10-fold dilution, 2.5 µl of the resulting cDNA was used as a template in PCR reactions using SYBR Green dye (Sigma, St. Louis, MO). The PCR reactions were
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!