Log In Sign up
The largest database of trusted experimental protocols

Amaxa kit r

Manufactured by Lonza
Visit Supplier

The Amaxa Kit R is a laboratory equipment product designed for nucleic acid transfection. It provides the necessary components for efficient delivery of DNA, RNA, or other macromolecules into cells. The kit includes solutions, reagents, and specialized cuvettes to facilitate the transfection process.

Automatically generated - may contain errors

Lab products found in correlation

D 001810, by Horizon Discovery (1 mentions) Aria 2 fluorescence activated cell sorter, by BD (1 mentions) Nucleofector device, by Lonza (1 mentions)

Close spelling variants of this product

Amaxa Cell Line Nucleofector Kit R (21 citations) Amaxa nucleofector kit R (4 citations) Amaxa Cell Line Nucleo- factor Kit R (3 citations) Amaxa kits (2 citations)

5 protocols using amaxa kit r

1

Stable mESC Line Generation Using CRISPR

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Flag-USP21 WT/SD/SA mESC stable cell line was generating using CRISPR-CAS methods62 (link). In brief, guide RNA (gRNA) expression vectors were constructed for pGS3-T7-gRNA. The sequence of gRNA (target to Rosa26) is 5′-TCGTGATCTGCAACTCCAG-3′. Flag-USP21 was ligated to the Sall and MluI site of Rosa26-puro-CAG donor vector. Then, we inserted the Flag-USP21 into the mouse Rosa26 safe harbour site via homologous recombination. An amount of 40 μg donor vector was electroporated into 0.3–0.4 million E14 cells along with 5 μg each of the Rosa26 gRNA and pCas9-GFP plasmid (Amaxa kit R, program A-24; Lonza). One week after electroporation, cells were replated into 150-mm dishes at clonal density. Individual colonies were subsequently selected under the fluorescence microscope and expanded in 24-well dishes. Analysis of Flag-USP21 stable cell line by western blotting.
Jin J., Liu J., Chen C., Liu Z., Jiang C., Chu H., Pan W., Wang X., Zhang L., Li B., Jiang C., Ge X., Xie X, & Wang P. (2016). The deubiquitinase USP21 maintains the stemness of mouse embryonic stem cells via stabilization of Nanog. Nature Communications, 7, 13594.
+ Open protocol
+ Expand
2

TALEN and sgRNA-Mediated Genetic Modification

Check if the same lab product or an alternative is used in the 5 most similar protocols
TALENs were generated as described (Kim et al., 2013 ), and sgRNAs were generated by hemi-nested PCR-amplified construction of a U6 promoter-driven sgRNA, which was blunt-end cloned into SmaI-cut pBluescript (Addgene). 10 µg sgRNA-containing plasmids were co-nucleofected into 3 × 106 G1E cells with Cas9-expressing plasmid using Amaxa Kit R (Lonza). 72 h post-transfection, cells were cloned at limiting dilution in a 48 well plate. Cells were screened after 1 week to detect mutations using T7 endonuclease test (Cho et al., 2013 ; Kim et al., 2009 (link)). DNA was amplified by PCR, denatured, reannealed to facilitate heteroduplex formation, incubated with T7 Endonuclease I (New England Biosystems) for 15 min. Clones containing target mutations were sequence-validated. Validation of allele-specific primers was conducted using template or mutant cell cDNA.
Hewitt K.J., Kim D.H., Devadas P., Sanalkumar P., Zuo C., Sanalkumar R., Johnson K.D., Kang Y.A., Kim J.S., Dewey C.N., Keles S, & Bresnick E.H. (2015). Hematopoietic Signaling Mechanism Revealed From a Stem/Progenitor Cell Cistrome. Molecular cell, 59(1), 62-74.
+ Open protocol
+ Expand
3

NCBP2-AS2 Silencing in cCAFs and pCAFs

Check if the same lab product or an alternative is used in the 5 most similar protocols
cCAFs and pCAFs 90% confluent were harvested and 2x106 cells were used in each transfection accordingly to the manufacturer's protocol using the program T-20 and the Amaxa kit R (Lonza). Cells were transfected with 1-3 nM of the non-targeting siRNA as a control (D-001810-10-05, GE Healthcare Dharmacon) or with siRNAs targeting NCBP2-AS2 (NCBP2-AS2 #1: CTGGTATAGCAGGACAGTTAA; NCBP2-AS2 #2: CAGGCAAGATGTGTTAAGAAT) (Qiagen). Cells were used for experiments 24h after silencing.
Kugeratski F.G., Atkinson S.J., Neilson L.J., Lilla S., Knight J.R., Serneels J., Juin A., Ismail S., Bryant D.M., Markert E.K., Machesky L.M., Mazzone M., Sansom O.J, & Zanivan S. (2019). Hypoxic cancer-associated fibroblasts increase NCBP2-AS2/HIAR to promote endothelial sprouting through enhanced VEGF signaling. Science signaling, 12(567), eaan8247.
+ Open protocol
+ Expand
4

Fluorescent Protein Expression in NK92 Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
mApple-LAMP1-pHluorin-N-8 was a gift from Dr. Michael Davidson (Addgene #54918). A LifeAct expressing plasmid was a gift from Dr. Janis Burkhardt (University of Pennsylvania). The LeGO-E plasmid containing Emerald-GFP was a gift from Dr. Boris Fehse (Addgene #27359) and LifeAct was cloned into BamHI and EcoRI restriction sites to create LifeAct.mEmerald. mTurquoise was a gift from Dr. Theodorus Gadella (University of Amsterdam). LifeAct.mTurquoise was generated by cloning LifeAct into the XhoI and EcoRI restriction sites of MIGR1 mTurquoise. NK92 cell lines were generated by retroviral transduction as previously described [16 (link)] or nucleofection using Amaxa Kit R per manufacturer’s instructions (Lonza). Positive cells were amplified under antibiotic selection pressure and were sorted for low, intermediate or high expression of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions by confocal, STED, TIRF or SIM.
Carisey A.F., Mace E.M., Saeed M.B., Davis D.M, & Orange J.S. (2018). Nanoscale Dynamism of Actin Enables Secretory Function in Cytolytic Cells. Current Biology, 28(4), 489-502.e9.
+ Open protocol
+ Expand
5

Transient and Stable Gene Knockdown in Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
For transient expression or siRNA knockdown, 2 × 106 fibroblasts were harvested and used in each transfection with a Nucleofector device (Lonza) according to the manufacturer’s protocol using the program T-20 and the Amaxa kit R (Lonza). Cells were transfected with 1–3 nM non-targeting siRNA as a control (GE Healthcare Dharmacon, catalogue no. D-001810-10-05) or with siRNAs targeting PDK2 and PYCR1 (Dharmacon, pool of four), with 5 µg pGCA-PDK2N255A or pGCA-PDK2WT (provided by A. McQuibban, University of Toronto) or with 5 µg pENTER-PYCR1 or pENTER plasmids (AMSBIO). Cells were used for experiments 48–72 h after transfection.
For stable knockdown of PYCR1 and PYCR2, shPYCR1 (Sigma catalogue no. TRCN000038983), shPYCR2 (Sigma catalogue no. TRCN0000046368) and shCTL (Sigma catalogue no. SHC016) lentivirus were generated in HEK293 cells. Two rounds of viral transduction in pCAF2 were performed on consecutive days. Cells were selected using 2 µg ml−1 puromycin.
Kay E.J., Paterson K., Riera-Domingo C., Sumpton D., Däbritz J.H., Tardito S., Boldrini C., Hernandez-Fernaud J.R., Athineos D., Dhayade S., Stepanova E., Gjerga E., Neilson L.J., Lilla S., Hedley A., Koulouras G., McGregor G., Jamieson C., Johnson R.M., Park M., Kirschner K., Miller C., Kamphorst J.J., Loayza-Puch F., Saez-Rodriguez J., Mazzone M., Blyth K., Zagnoni M, & Zanivan S. (2022). Cancer-associated fibroblasts require proline synthesis by PYCR1 for the deposition of pro-tumorigenic extracellular matrix. Nature Metabolism, 4(6), 693-710.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!