Psih1 h1

The lentiviral shRNA expression system from biosciences (catalogue no# s SI500A-1) was used for pSIH-H1 shRNA cloning and generating the expression lentivectors (pSIH1-H1-Puro, pSIH1-H1-H2Kk and pSIH1-H1-copGFP Vectors) as per the manufactures’ protocol. The pSIH-H1 vectors are designed to express a single-stranded shRNA sequence with a fold-back stem-loop structure (also known as a “hairpin”) from a RNA polymerase III H1 promoter. For DNA scale-up of pLenti-GFP lentiviral vector, the pSIH1-H1 (Codes for GFP, System Biosciences) was transformed into DH5α competent cells, and purified Lentiviral vector was obtained using Qiagen maxi column kit (QIAGEN Inc, Valencia, CA, USA).

Short hairpin RNA (shRNA) template oligonucleotides (synthesized by the Mayo Clinic Molecular Biology Core Facility) were ligated into the lentiviral shRNA cloning and expression vector pSIH1-H1 (System Bioscience, Mountain View, CA. The control shRNA sequence was CAACAAGATGAAGAGCACCAA (Sigma). The targeting sequence for ubiquitin-specific peptidase 10 (USP10) was GCCTCTCTTTAGTGGCTCTTT. Lentivirus production using 293T cells and transduction of target cells were performed as previously described [24] (link). Puromycin (2 µg/mL; Sigma, P8833) was added at 48 h post-transduction, and Puromycin-resistant cells were utilized.