The largest database of trusted experimental protocols

5 protocols using mirvana mimic control

1

Transient miR-4649-5p overexpression and PIP5K1C knockdown in TNBC

Check if the same lab product or an alternative is used in the 5 most similar protocols
To achieve transient overexpression of miR-4649-5p or knockdown of PIP5K1C, TNBC cell lines were transfected with 10 nM mirVana™ hsa-miR-4649-5p mimic or mirVana™ mimic control (Thermo Fisher Scientific) and 20 nM PIP5K1C siRNA #8 (targeting sequence: TTCCTGTACTGTAAAGACTAA; Qiagen) or AllStars Negative Control siRNA (Qiagen), respectively.
Cells in 6-well plates or 6 cm dishes were transfected using the HiPerFect Transfection Reagent (Qiagen) following the fast-forward transfection protocol of the manufacturer. Cells in 96-well plates were transfected according to the reverse transfection protocol. To confirm efficient overexpression or knockdown 48 h after transient transfection, quantitative RT-PCR was applied.
+ Open protocol
+ Expand
2

Validating miR-4649-5p Binding to PIP5K1C

Check if the same lab product or an alternative is used in the 5 most similar protocols
To confirm the direct interaction of miR-4649-5p with the putative target PIP5K1C, a 60 nt region of the 3′ UTR of PIP5K1C containing a predicted binding site for the miRNA was inserted into the dual luciferase reporter vector pEZX-MT06 (Genecopoeia, Rockville, MD, USA). Both the wild-type (5′ CCCCAAACACTGGTTTGCATCCCAGGTTCCTCGCCCACCTACCCCCGCCACACCCCGTCT 3′) and a mutated binding site sequence (5′ CCCCAAACACTGGTTTGCATCGTAGGTTCCAGGTTCACCTACCCCCGCCACACCCCGTCT 3′) were used. An empty control plasmid (CmiT000001-MT06; Genecopoeia) was employed as a reference control. For the luciferase assay, HEK293 cells were seeded in 24-well plates. Once cells reached 70–80% confluence they were co-transfected with 200 ng pEZ-MT06 PIP5K1C wt/mutated reporter vector or control vector and 50 nM mirVana™ miR-4649-5p mimic or mirVana™ mimic control (Thermo Fisher Scientific) using Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific) and Opti-MEM Reduced Serum Medium (Thermo Fisher Scientific) according to the manufacturer’s instructions. Cells were harvested 24 h after transfection and the Luc-Pair Luciferase Assay Kit 2.0 (Genecopoeia) was performed according to the user manual. Luminescence was measured with a LUMIStar Omega luminometer (BMG LabTech). The firefly luciferase signals were normalized by the renilla luciferase signals.
+ Open protocol
+ Expand
3

miR-4646-5p Binding to GRAMD1B 3'UTR

Check if the same lab product or an alternative is used in the 5 most similar protocols
To test for the direct interaction of miR-4646-5p with GRAMD1B, a 49 nt region of the 3′ UTR of GRAMD1B containing a predicted binding site was inserted into the dual luciferase reporter vector pEZX-MT06 (Genecopoeia, Rockville, MD, USA). In addition to the wild-type sequence (5′ GCACAGCCAGAAGCCAAAACTATTCCCAGAAAGTTTTG AATGCAAAACT 3′) a mutated sequence (5′ GCACAGCCAGAAGCCAAAACTATAGCTGGCAAGTTTTGAATGCAAAACT 3′) was also used. An empty control plasmid (CmiT000001-MT06; Genecopoeia) served as a reference control. HEK293 cells were seeded in 24-well plates and cultured until the cells reached 70–80% confluence. Cells were then co-transfected with 200 ng pEZ-MT06 GRAMD1B wt/mutated reporter vector or control vector and 50 nM mirVana™ miR-4646-5p mimic or mirVana™ mimic control (Thermo Fisher Scientific) or 50 nM hsa-miR-4646-5p miRCURY LNA miRNA Inhibitor and miRCURY LNA miRNA Inhibitor Control A (Qiagen), using Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific) and Opti-MEM Reduced Serum Medium (Thermo Fisher Scientific) according to the manufacturer’s instructions. Cells were harvested 24 h after transfection and the Luc-Pair Luciferase Assay Kit 2.0 (Genecopoeia) was applied according to the user manual. Luminescence was measured using a LUMIStar Omega luminometer (BMG LabTech). The firefly luciferase signals were normalized to the renilla luciferase signals.
+ Open protocol
+ Expand
4

Luciferase Assay for miR-652 Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were seeded into 24 well plates at 1.5 × 105 cells/well in DMEM + 10% FBS media. Cells were transfected 24 hours later using Lipofectamine® 3000 Transfection Reagent (ThermoFisher Scientific), according to manufacturer`s protocol with 10 ng of either wild-type or mutant pMIR-PPP2R3A reporter plasmid containing firefly luciferase, together with 10 ng of pRL-TK plasmid (Promega, Wisconsin, USA), and 20 pmol of either miR-652 mimic (hsa-miR-652-3p; mirVana™ #MC12699, ThermoFisher Scientific) or (syn-hsa-miR-652-3p miScript mimic; MSY0003322, Qiagen), or scrambled negative control (mirVana™ control mimic #4464058, Thermofisher) were transfected per well. For blocking experiments, 40 pmol of anti-hsa-miR-652-3p miScript miRNA inhibitor (Qiagen) was added per well. Twenty-four hours after transfection, Firefly and Renilla luciferase activity were measured using Dual-Glo Luciferase Reporter Assay System (Promega). The Renilla luciferase activity was normalized to the Firefly luciferase activity. Transfections were done in triplicate, and replicated thrice. A 2-tailed T-test was performed. P-values < 0.05 were considered significant.
+ Open protocol
+ Expand
5

Overexpression and Knockdown of miR-652 in Prostate Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCMV-MIR plasmid containing human miR-652 (MI0003667, Origene) or empty vector control (pCMVMIR, Origene) was transfected into PC3 or LNCaP cells using Lipofectamine™ 3000 transfection reagent (Life Technologies). Briefly, for 10 cm2 surface area, 5 µg of plasmid DNA was transfected together with 10 µl of Lipofectamine™ 3000 and 10 µl of P3000 reagent. Cells were passaged into fresh media 48 hours post-transfection. Selection reagent, G418 (400 µg/ml), was added 48 hours post-transfection. Once stable cells were established, the GFP+ population was further selected by flow cytometric cell sorting. For transient transfection, PC3 (105/ml) or LNCaP (2 × 105/ml) cells were seeded 24 hours prior to transfection in 6 well plates. Immediately prior to transfection, regular media was replaced with media containing 1% FBS. Transfections were performed using Lipofectamine® RNAiMAX transfection reagent (Thermofisher) according to manufacturer’s recommendations. For prolonged transient transfection, every 3–4 days, media was changed and cells were retransfected with 10 pmol/ml of miR-652 (hsa-miR-652-3p; mirVana™ #MC12699, Thermofisher), or negative control mimic (mirVana™ control mimic #4464058, Thermofisher). For blocking experiments, 20 pmol/ml of anti-hsa-miR-652-3p miScript miRNA inhibitor (Qiagen) were added per well.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!