Total RNA in plasma was isolated using miRNeasy Plasma Kit (QIAGEN, Germany) following the manufacturer's instructions. First-strand cDNA was synthesized using PrimeScript RT reagent kit (Takara, Japan) from 2 μL of total RNA. Quantitative real-time PCR was performed using the StepOnePlus system (Applied Biosystems, America) with SYBR Premix Ex Taq (Takara, Japan). The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China). The miRNA-155 expression values were normalized to snRNA U6 expression and were calculated using the 2–ΔΔCt relative quantification method.
Stem loop reverse transcription primers
Manufactured by RiboBio
Sourced in China
Stem-loop reverse transcription primers are oligonucleotides designed for the reverse transcription of RNA samples. They facilitate the conversion of RNA into complementary DNA (cDNA) for subsequent analysis or amplification.
Automatically generated - may contain errors
2 protocols using stem loop reverse transcription primers
1
Quantifying Plasma miRNA-155 Expression
2
Serum miRNA Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 3 ml of blood was collected in a vacuum tube at the time of enrollment. Total RNA from the serum samples was extracted using a miRNeasy Mini Kit (Qiagen, Germany) according to the Qiagen supplementary protocol. First-strand cDNA was made using a PrimeScript RT reagent kit (Takara, Japan) from 2 µl total RNA. Quantitative real-time PCR was performed with a StepOnePlus system (Applied Biosystems, America) using SYBR Premix Ex Taq (Takara, Japan). The stem-loop reverse transcription primers and PCR primers for the genes of interest were purchased from Ribobio (Guangzhou, China). The miRNA expression values were normalized to the snRNA U6 expression data and were calculated using the 2 -ΔΔCt relative quantification method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!