Tissues were sectioned on a cryostat (Leica, Microsystems Ltd., Milton Keynes, UK) with either a 7 µm thickness for immune-histochemical analysis or at 20 µm thickness for the extraction of RNA. Approximately 20 sections from the same patient sample biopsy were pooled and homogenised in an ice-cold TRI reagent (Sigma-Aldrich, Poole, UK) using a hand-held homogeniser (Cole Palmer, London, UK). RNA was extracted from the tissues following the manufacturer’s instructions, and the same protocol was also used to extract RNA from cultured cell lines. Samples were standardised and cDNA was subsequently generated (BioRad, Hemel Hempstead, UK).
Handheld homogeniser
Manufactured by Cole-Parmer
Sourced in United Kingdom
The Handheld homogeniser is a compact, portable laboratory device designed to mix and blend small samples. It features a high-speed motor that rapidly agitates samples to ensure thorough homogenization. The device is suitable for various applications in research and testing laboratories.
Automatically generated - may contain errors
Lab products found in correlation
Tri reagent, by Merck Group (2 mentions)
Tripure, by Roche (2 mentions)
Cryostat, by Leica (1 mentions)
Oligo dt kit, by Promega (1 mentions)
High pure rna tissue kit, by Roche (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
White 384 well plates, by Roche (1 mentions)
Random hexamer, by Thermo Fisher Scientific (1 mentions)
Lc 480 2 system, by Roche (1 mentions)
Transcriptor reverse transcriptase, by Roche (1 mentions)
Dntps, by Roche (1 mentions)
5 protocols using handheld homogeniser
1
Cryosectioning and RNA Extraction from Tissue Samples
2
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue samples were homogenised in TRI reagent (Sigma-Aldrich, Dorset, UK) using a handheld homogeniser (Cole Parmer, Cambridgeshire, UK) and RNA extraction undertaken in accordance with the manufacturers’ guidelines. RNA concentrations were standardised, to allow sample normalisation, and used as a template to generate cDNA using a GoScript reverse transcription mix, Oligo (dT) kit (Promega, Southampton, UK) in accordance with the manufacturers’ guidelines.
3
RNA Extraction and Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using a hybrid method of phenol extraction (TriPure; Roche, Welwyn Garden City, United Kingdom) and combined with column purification (High Pure RNA tissue Kit; Roche).14 (link) Dorsal root ganglion samples were first homogenised in TriPure using a handheld homogeniser (Cole-Palmer, Saint Neots, United Kingdom). For IPS cells, TriPure was added directly to the well after removal of media. The concentration of RNA in the samples was measured using a nanodrop. Total RNA was provided to the sequencing centre, and the ribodepleted fraction was selected for further sequencing. In rats, this was the polyadenylated fraction. It was then converted to cDNA using the strand-specific deoxy-UTP strand-marking protocol.
4
RNA Extraction and cDNA Synthesis from Biopsy Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Multiple sections from the same patient sample biopsy were combined and homogenised in ice-cold TRIzol reagent (Sigma-Aldrich, Poole, UK) using a handheld homogeniser (Cole-Parmer, London, UK). RNA was subsequently extracted following the manufacturer's instructions. Following extraction, RNA was resuspended in diethyl pyrocarbonate (DEPC) H2O and quantified using a spectrophotometer (WPA UV 1101; Biotech Photometer, Cambridge, UK). The samples were then standardised prior to undertaking the reverse transcription reaction using an RT kit (Bio-Rad, Hemel Hemstead, UK) to generate cDNA.
5
Quantitative RT-PCR Analysis of Sciatic Nerve
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh sciatic nerves were collected, immediately frozen in liquid nitrogen and stored at −80C. Tissues were then homogenised in TriPure (Roche) with a handheld homogeniser (Cole‐Parmer), treated with chloroform and purified with a High Pure Tissue Kit (Roche). RNA was eluted in RNase free water and cDNA was synthesised using a Transcriptor reverse transcriptase (Roche), random hexamers (Invitrogen) and dNTPs (Roche). cDNA amplification (5 ng) was done using the LighCycler 480 SYBR Green Master (Roche) and primers (0.5 μM). White 384 well plates (Roche) were run for 45 cycles in a LC 480 II system (Roche). MME primers were designed using Primer‐BLAST (https://www.ncbi.nlm.nih.gov/tools/primer‐blast/ ) and validated before the experiment. The MME primer used for KO mice was specifically designed in order to include exons 12 and 13 that were modified to obtain the KO mouse model: CAGCCTCAGCCGAAACTACA (forward primer) and ACATAAAGCCTCCCCACAGC (reverse primer). Gene expression was normalized against three reference genes (GAPDH, HPRT1, and 18S) and calculated by the ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!