Ariamx3005

Total RNA of P. extremaustralis, wapH and pSEVAwapH strain was extracted from 24 h cultures incubated at 30°C using the RNAeasy Mini Extraction Kit (Quiagen) following the manufacturer’s instructions followed by DNaseI treatment for 2 h. The RNA was quantified using NanoDrop 2000 (Thermo Fisher Scientific) and used for qPCR experiments. Expression was detected using the Power Sybr RNA to Ct 1 step kit (Termo Fisher Scientific) following manufacturer’s instructions with the following oligonucleotides: cprX5′ CGGTGAGGGTGAATTCCTGT 3′ and 5′ ATCCTCGGCCTTGAATTGGG 3′, wapH. 5′CAGTTCTGCCACGGCTATGA ′3 and 5′ GGATGGCCTTGGAGCTGAAT′3; mig145′GGCTCGGTGATTTTCCTCCA ′3 and ′5′CCAACGGTCCTTGTACTCCC ′3 and for PE143B_0104935 5′AATGGCCTGCGTTACCTCAA′3 and 5′ATGACCATCACCCGTTGCTT′3. The 16S rRNA gene using primers 5′GTAACTGCCCTTCCTCCCAA′3 and 5′AGGTAATGGCTACCAAGGC′3 was used as reference for normalization of expression levels of target genes in each condition. The cycling conditions were as follows: cDNA production 48°C during 30 min, for qPCR denaturation at 95°C for 5 min, 40 cycles at 95°C for 25 s, 60°C for 15 s, and 72°C for 15 s. Relative changes in the expression of individual genes was obtained using ΔΔCt method [36 (link)]. At least three independent cultures were analyzed for each condition. RT qPCR was performed using AriaMx3005 (Agilent).

Total RNA from HG001, Rom^R and Rom^R ΔfarE strains was extracted from 8 h cultures in TSB medium using the RNAeasy Mini Extraction Kit (Qiagen) following the manufacturer’s instructions followed by DNaseI treatment overnight (Promega). The RNA was quantified using NanoDrop 2000 (Thermo Fisher Scientific) and used for qPCR experiments. Expression was detected using the Power Sybr RNA to Ct 1 step kit (Thermo Fisher Scientific) following manufacturer’s instructions with the following oligonucleotides: psmα1 5′TCATCGCTGGCATCATTA′3 and 5′CATCGTTTTGTCTCCTG′3. The gyrB gene using primers 5′TTAGTGTGGGAAATTGTCGATAAT′3 and 5′AGTCTTGTGACAATGCGTTTACA′3 was used as reference for normalization of expression levels of target genes in each condition. The cycling conditions were as follows: cDNA production 48°C during 30 min, for qPCR denaturation at 95°C for 5 min, 40 cycles at 95°C for 25 s, 60°C for 1 min. Relative changes in the expression of individual genes was obtained using −ΔΔCt method. At least three independent cultures were analyzed for each conditions. RT qPCR was performed using AriaMx3005 (Agilent).