Cells were washed twice with ice-cold PBS after reaching near confluency and harvested by use of the RIPA lysis buffer and protease/phosphatase inhibitor (Servicebio) and Cocktail, 50× (Servicebio), and their concentrations were detected by BCA (Thermo Fisher Scientific). Cell extracts containing equal amounts of total proteins were separated by 4%–20% SDS-PAGE (Super-PAGE™ Bis-Tris Gels) and transferred to a polyvinylidene fluoride (PVDF) membrane for Western blotting with different primary antibodies and then with secondary antibodies. Detection was performed by using the enhanced chemiluminescence (ECL) method with the Tanon-5200 imaging system (Beijing YuanPingHao Biotech Co., Ltd.). Antibodies against PZR (#9893), cortactin (#3503), phospho-cortactin (Y421) (#4569), FAK (#71433), phospho-FAK (Y397) (#8556), c-Src (#2109), and phospho-c-Src (Y416) (#59548), β-actin (#4967) were all from Cell Signaling Technology. Secondary antibodies coupled to horseradish peroxidase were obtained from Absin (abs20040ss).
Abs20040ss
Manufactured by Absin
The Abs20040ss is a laboratory equipment product. It serves as a core function, but a detailed description while maintaining an unbiased and factual approach is not available.
Automatically generated - may contain errors
Lab products found in correlation
Bicinchoninic acid (bca), by Thermo Fisher Scientific (1 mentions)
β actin, by Cell Signaling Technology (1 mentions)
Enhanced chemi luminescence (ecl), by Meilun (1 mentions)
Ab125219, by Abcam (1 mentions)
Trizol, by Takara Bio (1 mentions)
Pvdf membrane, by Thermo Fisher Scientific (1 mentions)
Ab76473, by Abcam (1 mentions)
Ab181602, by Abcam (1 mentions)
3 protocols using abs20040ss
1
Western Blot Analysis of Signaling Proteins
2
Western Blot Analysis of Cell Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cell proteins were extracted using a 99:1 mixture of cell lysate and protease inhibitor, added to loading buffer and then boiled in boiling water for 5 min. Denatured protein samples were electrophoresed on 10% SDS/polyacrylamide gel (SDS/PAGE), and then the proteins on the gel were transferred to PVDF membrane. The PVDF membranes were closed with 5% milk powder and incubated with primary antibodies for N-cadherin (United Kingdom, Abcam,ab125219,1:500), vimentin (United Kingdom, Abcam, ab125219, 1:500) and β-actin (China, Bioss, AH11286402), followed by incubation with secondary antibody (China, absin, abs20040ss, 1:5,000). Finally, exposure development was performed using an enhanced chemiluminescence kit (ECL; China, Meilunbio, MA0186).
3
Lentiviral Silencing of AGR2 in Breast Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For lentiviral transduction, the MCF‐7 and MDA‐MB‐231 cell lines were transiently transfected with the shRNA vector GV344 (hU6‐MCS‐CMV‐puromycin) obtained from Genechem. The stable knockdown cells were selected with puromycin (1 μg/mL). The sequences for the shRNAs were: shRNA‐1, CTCAAGTTGCTGAAGACTGAA; and shRNA‐2, GACAAACACCTTTCTCCTGAT.
We examined the mRNA levels of genes using quantitative real‐time PCR. Total RNA was extracted with TRIzol (9108; Takara), and mRNA levels were analyzed using 2× Super SYBR Green qPCR Master Mix (ES Science). The primer sequences for genes are shown in TableS3 .
The expression levels of AGR2 protein were determined using western blotting. Briefly, samples were resolved using 15% SDS‐PAGE gel and then electrotransferred onto PVDF membranes (Invitrogen). After sealing with 5% fat‐free milk for 2 h, the membranes were added with the first Ab (rabbit anti‐AGR2 [1:1000, ab76473; Abcam]) or control GAPDH (1:10,000, ab181602; Abcam) overnight at 4°C and then added with HRP‐conjugated secondary Ab (1:10,000, abs20040ss; Absin).
We examined the mRNA levels of genes using quantitative real‐time PCR. Total RNA was extracted with TRIzol (9108; Takara), and mRNA levels were analyzed using 2× Super SYBR Green qPCR Master Mix (ES Science). The primer sequences for genes are shown in Table
The expression levels of AGR2 protein were determined using western blotting. Briefly, samples were resolved using 15% SDS‐PAGE gel and then electrotransferred onto PVDF membranes (Invitrogen). After sealing with 5% fat‐free milk for 2 h, the membranes were added with the first Ab (rabbit anti‐AGR2 [1:1000, ab76473; Abcam]) or control GAPDH (1:10,000, ab181602; Abcam) overnight at 4°C and then added with HRP‐conjugated secondary Ab (1:10,000, abs20040ss; Absin).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!