Mir 181a

Manufactured by Qiagen

Sourced in Germany

MiR-181a is a laboratory equipment product developed by Qiagen. It is a microRNA (miRNA) detection and quantification tool. The core function of MiR-181a is to enable the analysis and measurement of miRNA-181a expression levels in biological samples.

Automatically generated - may contain errors

Lab products found in correlation

Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (2 mentions) Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions) Nc sirna, by Qiagen (1 mentions) Mir 34a, by Qiagen (1 mentions) Mir 146a, by Qiagen (1 mentions) Miscript reverse transcription kit, by Qiagen (1 mentions) Miscript sybr green pcr kit, by Qiagen (1 mentions)

Close spelling variants of this product

MiR-181a and b synthetic mimics MiRCURY LNA UniRT PCR primer for miR-181a-5p Syn-mmu-miR-181a miScript miRNA Mimic

2 protocols using mir 181a

Regulation of synoviocyte function

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cells were grown in 6-well dishes at a starting density of 1 × 10⁵ cells/well until a confluence of 85% in DMEM supplemented with 10% FBS; then, the media were replaced with DMEM 0.5% FBS for 6 h before transfection. Afterwards, synoviocytes were transfected with specific inhibitors of miR-34a, miR-146a, and miR-181a (Qiagen, Hilden, Germany), at the concentration of 50 nM, or with their relative negative controls siRNA (NC) (Qiagen, Hilden, Germany), at the concentration of 5 nM, in serum-free medium for a period of 24 h. Supernatants were removed and synoviocytes immediately harvested or incubated with visfatin (5 and 10 μg/mL) or resistin (50 and 100 ng/mL) for additional 24 h.

Cheleschi S., Gallo I., Barbarino M., Giannotti S., Mondanelli N., Giordano A., Tenti S, & Fioravanti A. (2019). MicroRNA Mediate Visfatin and Resistin Induction of Oxidative Stress in Human Osteoarthritic Synovial Fibroblasts Via NF-κB Pathway. International Journal of Molecular Sciences, 20(20), 5200.

+ Open protocol

+ Expand

Quantitative Profiling of miRNA and mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

An miScript Reverse Transcription Kit (Qiagen) was used to reverse transcribe RNA. PCR was carried out with an miScript SYBR green PCR kit (Qiagen) for miRNA, and PowerUp SYBR Green Master Mix (ThermoFisher Scientific) for mRNA. PCR products were detected with a QuantStudio 5 Real-Time PCR System (ThermoFisher Scientific). All reactions were repeated in triplicate. miRNA primers, miR-181a, miR-181b, miR-181c, and miR-181d were purchased from Qiagen. β-Actin (Fwd: GGGCTGTATTCCCCTCCATCG and Rev: CCAGTTGGTAACAATGCCATG) was used to normalize the MICU1 (Fwd: AACAGCAAGAAGCCTGACAC and Rev: CTCATTGGGCGTTATGGAG) expression.

Roman B., Kaur P., Ashok D., Kohr M., Biswas R., O’Rourke B., Steenbergen C, & Das S. (2020). Nuclear-mitochondrial communication involving miR-181c plays an important role in cardiac dysfunction during obesity. Journal of molecular and cellular cardiology, 144, 87-96.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!