Strains harboring the HdpA mutant library and the control strain expressing wildtype HdpA were initially cultured in LB medium for 2 h at 37 °C and 250 rpm. Subsequently, they were transferred to M9 medium containing 20 g/L glucose and cultured for another 6 h under 2% arabinose induction. Cells were collected by centrifugation at 3000 rpm for 7 min followed by two washes with PBS (phosphate-buffered saline) buffer. The cell suspension was then diluted to an OD600 of 0.025 for analysis using the LSRFortessa X-20 Cell Analyzer (BD Biosciences) with excitation and emission wavelengths set at 566 nm and 610 nm. Further sorting was conducted using the FACSAria Fusion SORP (BD Biosciences), and the cells with top 0.1% of fluorescence intensity were collected on LB plates, where single colonies were incubated until appearance. Subsequently, the collected cells were individually fermented in M9 medium to determine fluorescence intensities and DHA concentrations after 72 h.
Facsaria fusion sorp
Manufactured by BD
The FACSAria Fusion SORP is a high-performance flow cytometry system designed for cell sorting and analysis. It features advanced optics, fluidics, and electronics to enable precise multi-parameter detection and sorting of diverse cell populations.
Automatically generated - may contain errors
Lab products found in correlation
Facsaria 2 sorp, by BD (2 mentions)
Px330 mcherry vector, by Addgene (2 mentions)
Lsrfortessa x 20 cell analyzer, by BD (1 mentions)
Ghost dye red 780, by Cytek Biosciences (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (1 mentions)
Propidium iodide, by Thermo Fisher Scientific (1 mentions)
Facsymphony a5, by BD (1 mentions)
Cytofix cytoperm kit, by BD (1 mentions)
Cytoflex flow cytometer, by Beckman Coulter (1 mentions)
Lsrfortessa sorp, by BD (1 mentions)
Sytox red dead cell stain, by Thermo Fisher Scientific (1 mentions)
Hoechst 33342 ready flow reagent, by Thermo Fisher Scientific (1 mentions)
4d nucleofector, by Lonza (1 mentions)
P3 primary cell nucleofector solution, by Lonza (1 mentions)
6 protocols using facsaria fusion sorp
1
Screening HdpA Mutant Library for DHA
2
Flow Cytometry Cell Staining Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed with FACS buffer (PBS, 2% FBS, 2 mM EDTA) and stained with antibodies for 30 minutes at 4°C in less than 1 × 106/50 μL total volume. For viability staining, cells were stained with propidium iodide (Life Technologies) at a final concentration of 1 mg/mL or DAPI (Thermo Fisher Scientific) at a final concentration of 0.1 mg/mL immediately prior to analysis or sorting; or cells were stained with Ghost Dye Red 780 (Tonbo) for 30 minutes at 4°C in PBS prior to antibody staining. Intracellular staining was performed using the Cytofix/Cytoperm Kit (BD Biosciences). All cell-sorting steps were validated using post-sort analyses to verify the purity of the sorted cell populations. All antibodies used for flow cytometry are detailed in Supplemental Table 2 . Flow-cytometry analysis and FACS were performed on a CytoFLEX flow cytometer (Beckman Coulter), FACSymphony A5 (BD), FACSAria II SORP (BD), and FACSAria Fusion SORP (BD).
3
Efficient CRISPR-Cas9 Knockout Cell Line Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sense and anti-sense oligonucleotides for a guide RNA (sgRNA) were computationally designed for the selected genomic targets (http://crispor.tefor.net ) and were cloned into pX330-mcherry vector (Addgene, 98750) which expresses red fluorescence protein (49 (link)). Two sgRNA sets were designed for THUMPD2 and THUMPD3, respectively. The sgRNA sequences for relevant genes and targeting sites are shown in Figure 1 . For generating KO cell lines, sgRNA plasmids were transfected in HEK293T cells using Lipofectamine 2000 as transfection reagent. After transfection for 36 h, HEK293T cells expressing red fluorescent protein were enriched by FACS Aria Fusion SORP (BD Bioscience) and plated into a dish at a very low density. After 7–14 days, single colonies were picked and plated into a well of a 96-well plate. Genotype of the stable cell lines was identified by sequencing single cloned PCR products based upon the following primers, and the target sites for PCR primers or the results for PCR products were shown in Supplementary Figure S1 .
THUMPD2-identify-primer forward: GGTAATTGAGTTTGAGGGTGATGA
THUMPD2-identify- primer reverse: CCCATACCCATAACAAAGCCACT
THUMPD3-identify- primer forward: CTCTGTGCCCATGTTTATTCAACC
THUMPD3-identify- primer reverse: CACAAACTGTCACTTGTTCTTTGG
THUMPD2-identify-primer forward: GGTAATTGAGTTTGAGGGTGATGA
THUMPD2-identify- primer reverse: CCCATACCCATAACAAAGCCACT
THUMPD3-identify- primer forward: CTCTGTGCCCATGTTTATTCAACC
THUMPD3-identify- primer reverse: CACAAACTGTCACTTGTTCTTTGG
4
Cell Cycle Analysis of Differentiated Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell cycle analysis of DE cells was performed using Hoechst 33342 Ready-Flow Reagent (Thermo Fisher Scientific) at 1 drop per 0.5 ml of cell suspension, incubated at 37 °C for 10 min. Cells were analyzed on FACSAriaFusion SORP or LSRFortessa SORP (both BD Biosciences) equipped with a UV laser (355 nm) for optimal excitation of Hoechst 33342. Dead cells were excluded using SYTOX™ Red Dead Cell Stain, for 633 or 635 nm excitation (ThermoFisher) in a 1:1000 dilution. Cell cycle profiles were analyzed with FlowJo v10.8.1 (BD). Doublets were excluded from analysis based on SSC-H versus -W and Hoechst-W versus -H plots.
5
CRISPR-Cas9 Genome Editing in HSPCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 nucleofection and rAAV6-mediated HDR were performed as previously described (19 (link), 43 (link)). Synthetic, chemically modified sgRNA targeting RUNX1 (5′-UACCUUGAAAGCGAUGGGCA-3′) and CCR5 (5′-GCAGCAUAGUGAGCCCCAGAA-3′) (25 (link)) and Cas9 protein (Alt-R HiFi CRISPR-Cas9) were purchased from Integrated DNA Technologies; sgRNAs targeting SOCS3 was purchased from Synthego as part of the CRISPR gene knockout kit (5′-CAGCAGGUUCGCCUCGCCGC-3′; 5′-GCACUGCGUUCACCACCAGC-3′; 5′-CAGGGGGCGGCUCAUCCCGG-3′). sgRNA was precomplexed with Cas9 protein at a molar ratio of 1:2.5 at 25°C for 10 minutes immediately prior to electroporation into HSPCs. HSPCs were electroporated 2 days after isolation using the Lonza Nucleofector 4D (program DZ-100) at 5 × 106 cells/mL and 150 μg/mL Cas9 protein in P3 Primary Cell Nucleofector Solution with 1× Supplement 1 (Lonza). For rAAV6-mediated HDR, rAAV6 donor vectors were added at a multiplicity of infection of 50,000 vector genomes/cell following electroporation, and cells were cultured for 3 days (including the 8-hour incubation with rAAV6 after electroporation) before isolation of CD34+ fluorescent protein double-positive populations by FACS using a FACSAria II SORP or FACSAria Fusion SORP (BD) for further experiments.
6
CRISPR-Cas9 Knockout Cell Line Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sense and anti-sense oligonucleotides for a guide RNA (sgRNA) were computationally designed for the selected genomic targets (http://crispor.tefor.net ) and were cloned into pX330-mcherry vector (Addgene, 98750) which expresses red fluorescence protein (41 (link)). Three sgRNA sets were designed for THUMPD2. The sgRNA sequences (5′ to 3′) for relevant genes and targeting sites in HEK293T, HeLa, and HeLa S3 cells are shown in Supplementary Figure S4A-C respectively. For generating KO cell lines, sgRNA plasmids were transfected into cells using EZ Cell transfection reagent (Life-iLab, Shanghai, China). After transfection for 36 h, cells expressing red fluorescent protein were enriched by FACS Aria Fusion SORP (BD Bioscience) and plated into 96-well plates. The genotype of the stable cell lines was identified by confirming the frameshift mutations in the target region of the genome.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!