Peripheral blood samples were collected from SLE patients and health controls. The serum was acquired by using a standard serum separator tube. Anti-dsDNA was quantified by autoantibodies profile assay kit (chemiluminescent microparticle immunoassay) (HOB, Jiangsu, China). Cell surface markers was stained with the following fluorochrome-labeled monoclone antibodies: FITC anti-CD19 (Clone# HIB19, Biolegend, San Diego, CA)，APC anti-CD69 (Clone# FN50, Biolegend, San Diego, CA). B cells from peripheral blood were isolated with the immunomagnetic cell sorting (MACS) (Miltenyi Biotec, Bergisch Gladbach, Germany). Total RNA in B cells was extracted using total RNA purification solutions (Invitrogen, Carlsbad, CA) and then transcribed into cDNA using commercial kits (TransGen, Beijing, China). The primers were designed according to Genbank sequences and synthesized by Invitrogen Company. Primers for the following transcripts were as follows: SMS1 CAACATTGGCGTAGACAT (forward), TAGGAGGTACTCGTTCGTG-(reverse)；GAPDH GCACCGTCAAGGCTGAGAAC (forward), TGGTGAAGACGCCAGTGGA (reverse). Then the expression of SMS1 was measured using Lightcycler 480II RT-PCR System (Roche, Switzerland).
Anti cd19 fitc
Manufactured by BioLegend
Sourced in United States
Anti-CD19-FITC is a fluorescently-labeled antibody that binds to the CD19 cell surface antigen. CD19 is a transmembrane protein expressed on B cells and plays a role in B cell activation and differentiation. This antibody can be used for the identification and enumeration of CD19-positive B cells in flow cytometry applications.
Automatically generated - may contain errors
Lab products found in correlation
Anti cd3 fitc, by BioLegend (4 mentions)
Anti cd11b apc, by BioLegend (3 mentions)
Anti cd4 bv421, by BioLegend (3 mentions)
Cytoflex lx, by Beckman Coulter (3 mentions)
Anti cd3 pe, by BioLegend (2 mentions)
Attune nxt, by Thermo Fisher Scientific (2 mentions)
Anti cd45 apc, by BioLegend (2 mentions)
Anti cd105 apc, by BioLegend (2 mentions)
Anti cd45 pacific blue, by BioLegend (2 mentions)
Anti cd4 pe, by BioLegend (2 mentions)
Anti cd8 apc, by BioLegend (2 mentions)
Anti cd163 pe, by BioLegend (2 mentions)
Anti cd56 apc cy7, by BioLegend (2 mentions)
Miltenyi gentlemacs with tumor dissociation kit for human cells, by Miltenyi Biotec (2 mentions)
Facscanto 2, by BD (2 mentions)
Anti cd3 percp, by BioLegend (2 mentions)
Anti cd8 bv605, by BioLegend (2 mentions)
Anti cd56 bv650, by BioLegend (2 mentions)
Anti cd16 bv650, by BioLegend (2 mentions)
Anti tlr 9 apc, by BioLegend (2 mentions)
30 protocols using anti cd19 fitc
1
SLE Autoantibody and B Cell Profiling
2
Isolation and Flow Cytometry Analysis of Immune Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were isolated from spleens and lymph nodes collected from 8-week-old sex-matched mice. Cells were blocked with anti-CD16/32 (Biolegend, #101301) (1:100 dilution) and then stained with the following antibody (1:200 dilution): FITC anti-CD19 (Biolegend, #152403), APC anti-CD11b (Biolegend, #101211) and PE anti-CD3 (Biolegend, #100205). The CD19+, CD3+, or CD11b+ cells were sorted using Becton Dickinson FACSAria II, rechecked by flow-cytometry to ensure purity at above 96%, then subjected to SDS-PAGE as described above.
3
Phenotypic Analysis of COVID-19 B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PBMCs from COVID-19 recovered patients and healthy donors were stained with specific antibodies as follows: FITC-anti-CD19 (302206, Biolegend), Pacific Blue-anti-CD38 (356628, Biolegend), PE-anti-CD24 (311106, Biolegend), Alexa Fluor 647 anti-CD27 (302812, Biolegend), and Brilliant Violet 510-anti-IgD (348220, Biolegend). For B-cell transformation analysis, PBMCs from COVID-19 recovered patients and healthy donors were incubated in complete medium with 10 μg/ml biotin-F(ab′)2 anti-human Ig(M + G) (109-066-127, Jackson) in 5% CO2 for 24 h. Cells were collected and stained with as previously described on ice for 30 min. After being washed twice by PBS, samples were collected and analyzed by a multicolor flow cytometer (Attune NxT, AFC2, ThermoFisher). Data were analyzed using the FlowJo software (TreeStar, USA).
4
Splenic B Cell Subset Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the analysis of splenic B cell subsets, cells were stained with different surface markers. The whole operation was kept on ice and out of light. The antibodies used are as follows: APC‐anti‐CD21 (123412; BioLegend), BV421‐anti‐IgM (406518; BioLegend), BV510‐anti‐B220 (103234; BioLegend), FITC‐anti‐CD19 (101506; BioLegend), PerCP/Cy5.5‐anti‐IgD (405710; BioLegend), FITC‐anti‐CD95 (152606; BioLegend), AF647‐anti‐GL7 (144606; BioLegend), percp‐7AAD (6084701; BD Pharmingen), and PE‐anti‐CD23 (101608; BioLegend). In addition, PE‐Cy7‐anti‐ki67 (1983210; Invitrogen) was used to label cells in the proliferation cycle and Annexin V (640906; BioLegend) was used to detect apoptosis. Data were acquired on Attune NxT (Thermo Fisher) and analyzed by the FlowJo software (TreeStar).
5
Oxidative Stress in COVID-19 Recovered B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PBMCs from COVID-19 recovered patients and healthy donors were stained with FITC-anti-CD19 (302206, Biolegend, USA) and DCFH-DA (S0033, Beyotime Biotechnology, China) on ice for 30 min. After being washed by PBS containing no FBS, PBMCs were incubated with 10 μg/ml biotin-F(ab′)2 anti-human Ig(M + G) on ice for 30 min, stimulated at 37 °C for 30 min, and then analyzed by flow cytometer (Attune NxT, AFC2, ThermoFisher). MFI of DCF in CD19+ B cells was measured using the FlowJo software (TreeStar, USA).
6
Tracking BCR Repertoire Dynamics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to obtain information on the BCR repertoire of different mice, blood was drawn and prepared as described above at defined time points. Time points were chosen at the age of 12, 24, 36, and 48 weeks for TCL1, TCL1 × Siglecg−/− mice and their corresponding controls and at the age of 28, 36, and 48 weeks for TCL1 × Siglecg‐R26ki/ki and TCL1 × Siglecg‐R26ki/ki × mb1cre mice and controls. Cells were stained with FITC‐anti‐CD19 (BioLegend, 1D3) for 30 min at 4°C. After incubation cells were washed with the nucleic acid binding dye 4′6‐diamino‐2‐phenylindol (DAPI) diluted 1:250 in PBS containing 0.5% FCS and 2 mM EDTA. CD19‐positive and DAPI‐negative cells were separated using a FACS Aria III cell sorter (Becton Dickinson) and collected in RLT buffer (RNeasy Plus Micro Kit; Qiagen). Subsequently, RNA isolation was performed using the RNeasy Plus Micro Kit from Qiagen according to the manufacturer's protocol and samples were stored at −80°C.
7
FCRL2 Expression Analysis in Multiple Myeloma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FCRL2 fluorescence-activated cell sorting (FACS) analysis was performed on primary cells, of 14 samples from patients with MM (13 bone marrow aspirates and one ascitic fluid) and 7 healthy donor samples (6 bone marrow samples and one peripheral blood). All samples contained isolated mononuclear cells and were stained with allophycocyanin (APC) anti-FCRL2 (Miltenyi Biotech, 130-107-439). For myeloma cell identification, we used BV421 anti-BCMA (BioLegend, 357519) and FITC anti-SLAMF7 (BioLegend, 331818). The different subpopulations of immune cells were distinguished by PE anti-CD138 (BD Pharmigen, 552026), FITC anti-CD19, PE anti-CD3 (both from BioLegend, 302206 and 344806) as well as PC7 anti-CD13, PE anti-CD33 and PE anti-CD34 (all from Beckman Coulter, B19714, A07775 and A07776). All antibodies were used in a dilution of 1:40. Data analysis was performed with FlowJo v10. Unstained controls were used to set the gates for the fluorochromes.
8
Flow Cytometry Antibody Panel for Immune Cell Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies used for flow cytometry include the following: FITC–anti-CD19 (rat IgG2a; 1:200, #115506; BioLegend), PE–anti-CD45.1 (mouse [A.SW] IgG2a; 1:100, #110707; BioLegend), PE/Cy7–anti-Thy1.1 (mouse IgG1; 1:100, #202518; BioLegend), BV421–anti-CD4 (rat IgG2b; 1:150, #100438; BioLegend), APC–anti-CD45.2 (mouse [SJL] IgG2a; 1:100, #109813; BioLegend), V500–anti-CD3e (Syrian hamster IgG2; 1:50, #560771; BD Biosciences), FITC–anti-CD25 (rat IgG2b; 1:100, #101907; BioLegend), PerCP/Cy5.5–anti-CD19 (rat IgG2a; 1:100, #152405, BioLegend), PerCP/Cy5.5–anti-NK1.1 (mouse IgG2a; 1:100, #108727; BioLegend), PerCP/Cy5.5–anti-CD8b (rat IgG2b; 1:100, #126609; BioLegend), BV605–anti-CD44 (rat IgG2b; 1:100, #103047; BioLegend), FITC–anti-CD8a (rat IgG2a; 1:100, #100705; BioLegend), BV510–anti-CD11b (rat IgG2b; 1:100, #101245; BioLegend), BV421–anti-Ly6C (RçAT IgM; 1:100, #562727; BD Biosciences), and PerCP/Cy5.5–anti-Ly6G (rat IgG2a; 1:100, #127615; BioLegend). For mass cytometry experiments, metal-tagged antibodies were obtained from Fluidigm or conjugated using the Maxpar X8 Antibody Labeling kit according to the manufacturer’s instructions (Fluidigm). Clone and tag information can be found in Table S1.
9
Multicolor Flow Cytometry Panel Design
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following antibodies/conjugates were purchased: Allophycocyanin (APC)-conjugated anti-CD3ε (TONBO, Cat# 20–0032, RRID:AB_2621538 , Burlingame, CA), fluorescein isothiocyanate (FITC)-conjugated anti-CD8α (BioLegend, Cat# 100706, RRID:AB_312745 , San Diego, CA), APC-rat anti-CD45R/B220 (BioLegend, Cat# 103212, RRID:AB_312997 ), Brilliant Violet (BV) 421-conjugated anti-CD11c (BioLegend, Cat# 117329 RRID:AB_10897814 ), AlexaFluor488-anti-CD11b (BioLegend), FITC-anti-CD19 (BioLegend, Cat# 152404 RRID:AB_2629813 ), FITC-anti-CD3ε (BioLegend, Cat# 100203 RRID:AB_312660 ), APC-anti-CD184 (CXCR4; BioLegend, Cat# 146508 RRID:AB_2562785 ), phycoerythrin (PE)-conjugated anti-MHC class II (BD Biosciences, San Jose, CA), PE-anti-CD86 (BioLegend, Cat# 105106 RRID:AB_313159 ), mouse anti-EEA1 (eBioscience, San Diego, CA), Alexa488-labeled goat anti-mouse IgG, and FITC-anti-LAMP1 (BioLegend, Cat# 121606 RRID:AB_572007 ).
10
Immunophenotypic Characterization of MSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolated and expanded MSCs were observed for plastic adherence and fibroblast-like spindle morphology. For flow cytometric characterization, 100 μl of MSC resuspended in culture medium at a concentration of 1–1,5 × 106 MSC/ml was incubated with 1,5 μl anti-CD73 [PE] (BioLegend cat. no. 344044), 1,5 μl anti-CD90 [APC-Cy7] (BioLegend cat. no. 328132), 5 μl anti-CD105+ [APC] (BioLegend cat. no. 323208), 0,5 μl anti-CD14 [FITC] (BioLegend cat. no. 301804), 0,5 μl anti-CD19 [FITC] (BioLegend cat. no. 302206) 0,5 μl anti-CD31 [FITC] (BioLegend cat. no. 303104), 1,5 μl anti-CD45 [FITC] (BioLegend cat. no. 368508), 0,5 μl anti-HLA-DR [FITC] (BioLegend cat. no. 307604) and 1 μl of 1 mg/mL 7-Aminoactinomycin D (7-AAD, AAT Bioquest, cat. no. ABD-17501) for 30 min at room temperature in dark. After incubation, 3 mL of PBS with 0.1% BSA was added to the cells, followed by centrifugation at 500 g for 5 min. The pelleted cells were resuspended in 400 μl of PBS with 0.1% BSA, followed by analysis on a Novocyte 3000 (Agilent). The acquisition rate was kept below 1.000 for all analyses. A fluorescence minus one-guided gating strategy was applied to identify positive and negative events. In all applied MSC batches, ≥90% of the viable cells expressed the positive markers CD73, CD90, and CD105, while ≤2% expressed the negative markers CD14, CD19, CD31, CD45, and HLA-DR.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!