Fast mutagenesis system kit
The Fast Mutagenesis System Kit is a laboratory tool designed to facilitate rapid and efficient introduction of genetic modifications. It enables the creation of targeted mutations in DNA sequences. The kit provides the necessary reagents and protocols to perform mutagenesis experiments in a controlled and reproducible manner.
Lab products found in correlation
64 protocols using fast mutagenesis system kit
Promoter Analysis of FOXD1 Gene
Site-directed mutagenesis of protein residues
The design sequence of the primer
Primer | Sequence (5′ to 3′) | Number of nucleobase |
---|---|---|
S387A | gagctcatcttccagtaggcgcaggtcttgtcacacag | 38 |
S387Aa | ctgtgtgacaagacctgcgcctactggaagatgagctc | 38 |
N533A | actgtaacccggatggcggaccgcacagacgg | 32 |
N533Aa | ccgtctgtgcggtccgccatccgggttacagt | 32 |
R535A | gccgtgactgtaaccgcgatgttggaccgcac | 32 |
R535Aa | gtgcggtccaacatcgcggttacagtcacggc | 32 |
Structural Analysis of GH5 Cellulases
Modeled structure of GtCel5. The unique hairpin structure is shown in green. Residues Tyr228 and Asn233 involved in the movement loop 6 are indicated
Site-Directed Mutagenesis of CGT Enzymes
Plasmid Mutagenesis and Cell Transfection
Lamin A/C Mutant Expression in HEK 293 Cells
Site-directed Mutagenesis of UPF0118
Recombinant FABP5 Protein Purification
Plasmid Transfection and Reporter Assay
Plasmids Construction for Viral Coat Protein Silencing
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!