The 30-mL urine samples were collected and centrifuged to obtain urine pellets. After being resuspended in PBS, the DNA from urine pellets was extracted by using a chemagic DNA Stool Kit (PerkinElmer) with a modified pretreatment bead-beating step. The 16S library was constructed on the basis of the prepared DNA samples and analyzed by using the NEXTFLEX 16S V4 Amplicon-Seq Library Prep Kit (Bioo Scientific). Paired-end sequencing was performed with the MiSeq Reagent Kit v2 Nano and the Illumina MiSEq 2000 high-throughput DNA sequencing service in April 2013. Cluster generation, sequencing, and analysis were all performed according to the manufacturer’s instructions. QIIME 2 microbiome analysis package was used to perform the bioinformatic analysis. Taxonomy classification used naïve Bayesian classifiers trained with the Reference Sequence databases.
Miseq reagent nano kit v2
Manufactured by Illumina
Sourced in United States
The MiSeq Reagent Nano Kit v2 is a consumable product for the MiSeq sequencing system. It provides the necessary reagents and consumables to perform next-generation sequencing experiments on the MiSeq platform.
Automatically generated - may contain errors
Lab products found in correlation
Miseq sequencer, by Illumina (8 mentions)
Miseq platform, by Illumina (7 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (6 mentions)
Ampure xp bead, by Beckman Coulter (4 mentions)
Miseq system, by Illumina (4 mentions)
High sensitivity dna kit, by Agilent Technologies (4 mentions)
Miseq instrument, by Illumina (3 mentions)
Nextera xt dna library prep kit, by Illumina (3 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (3 mentions)
Nextseq 500, by Illumina (3 mentions)
Newbler 2, by Roche (3 mentions)
Nextera xt index kit, by Illumina (3 mentions)
Chemagic dna stool kit, by PerkinElmer (2 mentions)
Nebnext ultra 2 dna library prep kit, by New England Biolabs (2 mentions)
Proteinase k, by Thermo Fisher Scientific (2 mentions)
2100 bioanalyzer, by Agilent Technologies (2 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (2 mentions)
S1 reagent kit v1, by Illumina (2 mentions)
High output v2 kit, by Illumina (2 mentions)
Novaseq 6000, by Illumina (2 mentions)
63 protocols using miseq reagent nano kit v2
1
Urine Microbiome Profiling Protocol
2
Microbial DNA Extraction from Stool
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After thawing the stool sample, bead beating to achieve lysis was performed using a FastPrep-24 (MP biomedical, USA) prior to DNA extraction. DNA was extracted using a Chemagic DNA Stool Kit (PerkinElmer, USA) and Chemagic 360 (PerkinElmer, USA) according to the manufacturer’s instructions. Prepared DNA samples were used for 16S library construction using NEXTflex 16S V4 (forward = 5′-TATGGTAATTGTGTGCCAGCMGCCGCGGTAA-3′; reverse = 5′-AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3′) Amplicon-Seq (Bioo Scientific, USA). Paired-end sequencing was performed with a MiSeq Reagent Kit v2 Nano using a MiSeq instrument according to the manufacturer’s instructions (Illumina, USA).
3
Amplicon Sequencing via Illumina MiSeq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fifteen µL of pooled purified amplicons per sample was sent to the Center for Health Genomics and Informatics (CHGI) at the University of Calgary for library preparation and sequencing. Each sample was indexed using the Nextera XT Index Kit V2 along with KAPA HiFi polymerase. The indexed libraries were pooled and sequenced in an Illumina MiSeq instrument (San Diego, CA) in paired-end mode (2 × 250 bp), using the Illumina MiSeq Reagent Kit V2 Nano (500 cycles), for a total of 1 million reads, with a 5% spike of Enterobacteria phage PhiX control.
4
Nextera XT DNA Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA library preparation was carried out using the Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA, USA) to generate indexed paired-end libraries from the PCR amplicons. The libraries were then loaded into the MiSeq sequencing system (Illumina) using the MiSeq Reagent Kit v2 Nano (2 × 150 reads).
5
Off-target Analysis of ABE-Treated HDFs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In silico prediction of putative off-target sites was performed using Cas-OFFinder with a query sequence of TAACAAGCAGAGCAGCACAC and an NGG protospacer adjacent motif, allowing for up to three mismatches between the query sequence and genomic off-target site. Genomic DNA extracted from ABE-treated (n = 3) and mock (n = 3) HDFs was PCR amplified with Taq RED (Apex Bioresearch Products) using site-specific primers (Table S2 ), generating fewer than 250 bp amplicons. Amplified DNA was electrophoresed on 0.7% agarose gels in TAE buffer, size selected, and gel purified using the Zymoclean Gel DNA Recovery Kit (Zymo Research). Amplicons were library prepped using the NEBNext Ultra II DNA Library Prep kit (New England Biolabs), according to the manufacturer’s protocol. Size selection of adaptor-ligated DNA was performed using AMPure XP beads (Beckman Coulter) using a bead/sample ratio of 0.7×. Adaptor-ligated DNA was enriched using universal and index primers, as per manufacturer’s protocol, with five PCR cycles. Libraries were run paired end on a MiSeq (Illumina) using the MiSeq Reagent Kit v2 Nano (Illumina) with 500 cycles generating more than 18,000 NGS reads/index primer, more than 1,000× reads/sample. One or both read files (.fastq) were analyzed using CRISPResso2 (Figure S10 ).25 (link)
6
CRISPR-Cas9 Off-Target Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplicon sequencing was performed using MiSeq (Illumina, Japan) and MiSeq Reagent Kit v2 Nano (Illumina, Japan) was used for analysis. Genomic DNAs were used to amplify the region of the CRISPR-Cas9 target sites or off-target sequences by PCR. One off-target candidate sequence (SL2.50 ch6:26946923-26946946) was selected by Cas-OT to examine the mutation. PCR products were separated by electrophoresis, purified from the agarose gel using the Wizard SV Gel and PCR Clean-Up System (Promega, Japan), and used as templates for a second round of PCR. Second PCR was performed using TruSeq HT primer (Illumina, Japan). All primers used for PCR are listed in Supplementary Table S1 . MiSeq data were analyzed using CLC Genomics Workbench software version 7.5.1 (CLC bio, Japan) and mapped on the off-target candidate using Integrative Genomics Viewer (IGV; Broad Institute).
7
Phage DNA Extraction and Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The purified phage sample (300 µL) was treated with 50 μg of proteinase K (20 mg/mL; ThermoFisher, Wlatham, MA, USA) and with an addition of SDS (Sigma-Aldrich) up to a 0.5% of final concentration before being incubated for an hour at +56 °C and subjected to DNA extraction using Genomic DNA Clean & Concentrator-10 (Zymo Research, Irvine, CA, USA) according to the manufacturer’s guidelines.
To prepare the input for the NGS library, 200 ng of phage DNA was randomly physically sheared using Covaris S220 focused-ultrasonicator (Covaris, Woburn, MA, USA) with a target fragment length of 550 bp. Fragmented DNA was used as an input for barcoded TruSeq DNA Nano Low Throughput Library Prep Kit (Illumina, San Diego, CA, USA) as per the manufacturer’s reference guide using adapter 7 from TruSeq DNA Single Indexes Set A (Illumina). The quality and quantity of the final library were verified using an Agilent 2100 bioanalyzer (Agilent, Santa Clara, CA, USA) with a high Sensitivity DNA kit (Agilent) and Qubit fluorometer (Invitrogen, Waltham, MA, USA) dsDNA high-sensitivity quantification assay (Invitrogen). Library sequencing was carried out on the Illumina MiSeq system (Illumina) using a 500-cycle MiSeq Reagent Kit v2 nano (Illumina) as one of the 12 pooled differently barcoded libraries.
To prepare the input for the NGS library, 200 ng of phage DNA was randomly physically sheared using Covaris S220 focused-ultrasonicator (Covaris, Woburn, MA, USA) with a target fragment length of 550 bp. Fragmented DNA was used as an input for barcoded TruSeq DNA Nano Low Throughput Library Prep Kit (Illumina, San Diego, CA, USA) as per the manufacturer’s reference guide using adapter 7 from TruSeq DNA Single Indexes Set A (Illumina). The quality and quantity of the final library were verified using an Agilent 2100 bioanalyzer (Agilent, Santa Clara, CA, USA) with a high Sensitivity DNA kit (Agilent) and Qubit fluorometer (Invitrogen, Waltham, MA, USA) dsDNA high-sensitivity quantification assay (Invitrogen). Library sequencing was carried out on the Illumina MiSeq system (Illumina) using a 500-cycle MiSeq Reagent Kit v2 nano (Illumina) as one of the 12 pooled differently barcoded libraries.
8
DNA Extraction and 16S rRNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction was conducted on samples from patients, as shown in Table 13 .
DNA was extracted using QIAamp® PowerFecal Kit (Qiagen) according to the manufacturer’s instructions. A dsDNA HS Assay Kit and Qubit® 4.0 fluorometer (Thermo Fisher Scientific) were used to measure the DNA concentration, and the quality of isolated DNA was analyzed through electrophoresis in 1% agarose gel.
DNA libraries were prepared using PCR amplification with gene-specific primers for the V3–V4 regions of 16S rRNA. The following processes were performed in accordance with Illumina instructions. The quality of the prepared libraries was analyzed on the Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA) using the High Sensitivity DNA kit (Agilent Technologies). A Qubit dsDNA HS Assay Kit and Qubit® 4.0 fluorometer were used to measure the DNA concentration. A MiSeq Reagent Kit V2 Nano was used to prepare the DNA for sequencing; then, the samples were sequenced using the Illumina MiSeq platform (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol, using reagents for double-ended reading and a read length of at least 250 bp. The amount of PhiX Control v3 was not less than 1%.
DNA was extracted using QIAamp® PowerFecal Kit (Qiagen) according to the manufacturer’s instructions. A dsDNA HS Assay Kit and Qubit® 4.0 fluorometer (Thermo Fisher Scientific) were used to measure the DNA concentration, and the quality of isolated DNA was analyzed through electrophoresis in 1% agarose gel.
DNA libraries were prepared using PCR amplification with gene-specific primers for the V3–V4 regions of 16S rRNA. The following processes were performed in accordance with Illumina instructions. The quality of the prepared libraries was analyzed on the Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA) using the High Sensitivity DNA kit (Agilent Technologies). A Qubit dsDNA HS Assay Kit and Qubit® 4.0 fluorometer were used to measure the DNA concentration. A MiSeq Reagent Kit V2 Nano was used to prepare the DNA for sequencing; then, the samples were sequenced using the Illumina MiSeq platform (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol, using reagents for double-ended reading and a read length of at least 250 bp. The amount of PhiX Control v3 was not less than 1%.
9
Targeted DNA Library Prep and Sequencing
10
16S rRNA Gene Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study, we amplified and sequenced the V4 region of the 16S rRNA gene. The extracted DNA was then utilized to construct a 16S rRNA gene library, employing the NEXTflex 16S V4 Amplicon-Seq kit from BioO Scientific (Austin, TX, USA). The quality of the prepared library was assessed using the 4200 Tape Station System from Agilent Technologies (Santa Clara, CA, USA). Meanwhile, we conducted paired-end sequencing using the MiSeq Reagent Kit v2 nano on a MiSeq 2000 system, following the instructions provided by Illumina (San Diego, CA, USA). To evaluate the overall quality of the Illumina MiSeq paired-end sequencing (PE, 2 × 250 nucleotides), we incorporated 12% PhiX DNA from Illumina (USA) into the sequencing runs.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!