Primer script one step rt pcr kit

Reverse transcription polymerase chain reaction (RT-PCR) was performed as previously described^{43 (link)}. Briefly, total RNA from brain tissues (cerebral cortex and hippocampus) were extracted using Trizol reagent (TaKaRa, Japan) and isolated using chloroform following the manufacturer’s instructions. RNA was converted to cDNA by using the Primer-Script One-Step RT-PCR kit (TaKaRa). Real-time PCR was performed using the ABI7500 system (Applied Biosystems, Carlsbad, CA) using the SYBR Premix Dimmer Eraser kit (TaKaRa) to amplify the cDNA template. The forward and reverse strand primers that were used to amplify the mRNA encoding mouse BDNF were ATTAGCGAGTGGGTCACAGC and TCAGTTGGCCTTTGGATACC, respectively. The primers were synthesized by Shanghai Sangon Biological Engineering Technology Company Limited. BDNF gene expression in each sample was normalized to β-actin expression. The relative expression level of mRNAs was calculated by the 2^−ΔΔCt method.
To assay BDNF synthesis, BDNF ELISA kit (Cusabio, China) was used to quantify protein concentration in cerebral cortex and hippocampus according to the manufacturer’s instruction.

TRIzol reagent (Invitrogen, USA) was used for RNA extraction from tissue samples and cell lines. Reverse transcription was performed with Primer-Script One Step RT-PCR kit (TaKaRa, China). RT-PCR was conducted with the SYBR Premix Dimmer Eraser kit (TaKaRa, China). Supplementary Table 1 shows the primers designed by Shanghai Sangon Biotech Co. Ltd. All the assays were performed with GAPDH as normalization in triplicate. The relative expression fold changes of RNAs was calculated with the 2^−ΔΔCt method.

Total RNA from tissues and cells was extracted using Trizol reagent (Invitrogen, CA). RNA was reversed transcribed into cDNAs using the Primer-Script™ one step RT-PCR kit (TaKaRa, Dalian, China). The cDNA template was amplified by real-time RT-PCR using the SYBR® Premix Dimmer Eraser kit (TaKaRa, Dalian, China). GAPDH was used as an internal control, and mRNA values were normalized to GAPDH. Real-time RT-PCR reactions were performed by the ABI7500 system (Applied Biosystems, CA). The relative expression fold change of mRNAs was calculated by the 2^-ΔΔCt method. The primer sequences were listed in the Additional file 1.

The salt treatments on soybeans were performed as previously described [22 (link)]. The seeds of the cultivated soybean accession C08 were germinated in vermiculite saturated with water. One-week-old seedlings were transferred to a hydroponic system with half-strength Hoagland’s nutrient solution. After the opening of the first trifoliate, the seedlings were treated with half-strength Hoagland’s solution containing 0.9% NaCl for different lengths of time (0 h, 1 h, 2 h, 4 h, 24 h, 48 h and 72 h). The roots and leaves of the treated plants were harvested separately and frozen in liquid nitrogen for total RNA extraction. Three individual plants of the same treatment were pooled as one sample and two independent biological replicates were performed for gene expression analyses.
Quantitative reverse-transcription PCR was performed using the PrimerScript one step RT-PCR kit (TaKaRa Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's instructions. The primers for qRT-PCR are listed in Table S4. Relative gene expression was calculated using the 2^−ΔΔCt method [60 (link)]. The data were normalized to the reference gene ELF1b [61 (link)]. The qRT-PCR reactions were performed with at least three replicates.

Total RNA from tissues and cells was extracted using Trizol reagent (TAKARA). RNA was reverse transcribed into cDNAs using the Primer-Script one step RT-PCR kit (TAKARA, Dalian, China). The cDNA template was amplified by real-time RT-PCR using the SYBR Premix Dimmer Eraser kit (TAKARA), which including U6 aliquot. Gene expression in each sample was normalized to GADPH or U6 expression. The primer sequences used were as follows: GAPDH, forward: 5’-GTCAACGGATTTGGTCTGTATT-3’ and reverse: 5’-AGTCTTCTGGGTGGCAGTGAT-3’; H19, forward: 5’-TTCAAAGCCTCCACGACTCT-3’ and reverse: 5’-: GCTCACACTCACGCACACTC-3’. FOXM1, forward: 5’-GAGACCTGTGATGGTGAGGC-3’ and reverse: 5’-ACCTTAACCTGTCGCTGCTC-3’. Real-time PCR reactions were performed using the ABI7500 system (Applied Biosystems, Carlsbad, CA, USA). The real-time PCRs were performed in triplicate. Relative expression fold change of mRNAs was calculated by the 2^−ΔΔCt method.

The total RNA was extracted from cells using TRIzol reagent (Invitrogen). The mRNA was then reverse transcribed using the Primer-Script One Step RT-PCR Kit (TaKaRa, Japan) and the miRNA was reversely transcribed using the miRNA First strand cDNA Synthesis Kit (Sangon Biotech, China). The cDNA templates of ANRIL and miR-7-5p were amplified by real-time PCR using SYBR Premix Dimmer Eraser Kit (TaKaRa, Japan) and MicroRNAs qPCR Kit (Sangon Biotech, China), respectively. Gene expression in each sample was normalized to GAPDH expression. The primer sequences used were as follows: for GAPDH, 5’-CAGGAGGCATTGCTGATGAT-3’ (forward) and 5’-GAAGGCTGGGGCTCATTT-3’ (reverse); for ANRIL, 5’-CAACATCCACCACTGGATCTTAACA-3' (forward) and 5’-ATCATTCTCCTCAAATTACAGAG-3’ (reverse); for PARP1, 5’-AGCTTCGTATCCCCAATGAGATACA-3’ (forward) and 5’-TTTCCATCAAACATGGGCGAC-3’ (reverse). The forward primer for miR-7-5p was (5’-CGGTGGAAGACTAGTGATTTTGTTG-3’) and the reverse primer for U6 was (5’-CTCGCTTCGGCAGCACA-3’). The universal reverse primer was (5’-AACGCTTCACGAATTTGCGT-3’). The relative expression fold change of mRNA and miRNA was calculated by 2^−△△Ct method.

Total RNA derived from ICC tissues and cells was extracted using TRIzol reagent (TaKaRa, Dalian, China), according to the manufacturer’s instructions. RNA was reverse-transcribed into cDNA using a Primer-Script one-step RT-PCR kit (TaKaRa, Dalian, China). The Hieff UNICON^® qPCR SYBR^® Green Master Mix (Yeasen, Shanghai, China) was used for qRT-PCR. The circRNA and mRNA levels were normalized by GAPDH, β-actin, or U3. The fold change in the relative expression of RNAs was calculated using the 2^−ΔΔCt method. The oligonucleotide sequences are listed in Additional File 2.