mRNA from OASFs and synovial tissue was isolated from OA patients and healthy donors using TRIzol™ Reagent. Complementary DNA (cDNA) was synthesized by the MMLV reverse transcription system (Invitrogen, Carlsbad, CA, USA) and mixed with Fast SYBR® Green Mix. Gene expression was assayed using the StepOnePlus™ Real-Time PCR System. The MMLV reverse transcription system (Invitrogen, Carlsbad, CA, USA) synthesized cDNA from total RNA and the FAST SYBR® RT-PCR kit was used to detect miRs. Relative mRNA expression was calculated using the 2–△△Ct method, with GAPDH as the internal reference. The primers used in the qPCR assays are listed in Supplementary Table 1 .
Mmlv reverse transcription system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The MMLV reverse transcription system is a laboratory equipment used for the conversion of RNA into complementary DNA (cDNA) molecules. It employs the Moloney Murine Leukemia Virus (MMLV) reverse transcriptase enzyme to facilitate this process.
Automatically generated - may contain errors
Lab products found in correlation
Fast sybr green mix, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Nanovue plus spectrophotometer, by Harvard Bioscience (2 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Lightcycler 96, by Roche (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Abi 7500 fast sequence detection system, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr mix, by Transgene (1 mentions)
Oligo dt 18, by Transgene (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by MDBio (1 mentions)
Iq5 multicolor real time pcr system, by Bio-Rad (1 mentions)
Sybr green real time rt pcr master mix, by Toyobo (1 mentions)
Lightcycler 480, by Bio-Rad (1 mentions)
Sybr green 1, by Bio-Rad (1 mentions)
7 protocols using mmlv reverse transcription system
1
Quantification of mRNA and miRNA Expression in OA
2
qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DM25 flask cultures were grown to mid exponential phase (OD420 0.03–0.04) after preconditioning strains as described for growth curves. RNA was extracted from these cultures using the RNeasy Mini kit (Qiagen, Valencia, CA) with on-column DNase treatment. First-strand cDNA synthesis was performed from purified total RNA (0.5 μg) using the Invitrogen M-MLV reverse transcription system with a gene-specific reverse primer for gltA or the ihfB reference gene. Total cDNA (1.25 ng) and primers were added to Power SYBR Green PCR master mix (Applied Biosystems, Grand Island, NY). Quantification cycle (Cq) values for each reaction were determined from qPCR reactions performed on a LightCycler 96 (Roche, Indianapolis, IN). Expression levels relative to strain EQ119 were calculated from these data using the 2-ΔΔCq method (Livak and Schmittgen, 2001 (link)).
3
RNA Extraction and RT-qPCR for HIF-1α and ADRP Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were dissolved in TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and total RNA was extracted, according to the manufacturer's protocol. Total RNA (1 µg) was converted into 1 µg cDNA using an M-MLV reverse-transcription system (Invitrogen; Thermo Fisher Scientific, Inc.) in the presence of oligo (dT)18 (Beijing TransGen Biotech Co., Ltd.). Reverse transcription-quantitative (RT-q)PCR was performed using an ABI-7500 Fast Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with SYBR® Green PCR mix (Beijing TransGen Biotech Co., Ltd.). The reaction system contained 10 µl 2X SYBR® Green PCR Master mix (Beijing TransGen Biotech Co., Ltd.), 4 pmol of each primer (Sangon Biotech Co., Ltd.) and 0.2 µl RT reaction product. The samples were set in triplicate. The thermocycling parameters were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec, and a detection step at 72°C for 30 sec. The specific gene primers were as follows: HIF-1α forward, 5′-AGG TGG ATA TGT CTG GGTTG-3′, HIF-1α reverse, 5′-AAG GAC ACA TTC TGT TTG TTG-3′; ADRP forward, 5′-GGC TAG ACA GGA TTG AGG AGAG-3′, and ADRP reverse, 5′-TCA CTG CCC CTT TGG TCTTG-3′. The relative abundance of the HIF-1α and ADRP transcript was quantified using the comparative Cq method (15 (link)), with β-actin as an internal control.
4
Quantitative RT-PCR Analysis of Murine Myoblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from murine myoblast cells using TRIzol™ reagent (MDBio, Taipei, Taiwan). qRT-PCR analysis was conducted according to our previous report [30 (link)]. RNA concentration was measured using a NanoVue Plus™ spectrophotometer (Biochrom Ltd., Cambridge, UK). 1 μg of total RNA was reverse-transcribed to complementary DNA (cDNA), which was then synthesized by the MMLV reverse transcription system (Invitrogen, Carlsbad, CA, USA) and mixed with Fast SYBR® Green Mix. Gene expression was quantified by the StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as the internal control, and all primers used in the qRT-PCR assays are reported in Supplementary Table S1 .
5
Antcin K-Mediated Gene Expression in RASFs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After incubating the RASFs with Antcin K (0, 0.3, 1, 3, or 10 μM) for 24 h, total RNA was extracted from the RASFs using TRIzol™ reagent. The qPCR analysis was performed as per an established protocol (16 (link)–18 (link)). RNA concentration was measured using a NanoVue Plus™ Spectrophotometer (Biochrom Ltd., Cambridge, UK). 1 μg of total RNA was reverse-transcribed to complementary DNA (cDNA), which was then synthesized by the MMLV reverse transcription system (Invitrogen, Carlsbad, CA, USA) and mixed with Fast SYBR® Green Mix. Gene expression was examined by the StepOnePlus™ Real-Time PCR System. GAPDH served as the internal control and the primers used in the qPCR assays are listed in Table 1
6
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol Reagent (Invitrogen). 1 μg of RNA was reverse transcribed with the M-MLV Reverse Transcription System (Invitrogen) according to the manufacture’s instructions. PCR was performed using the SYBR Green Real-time RT-PCR Master Mix plus (TOYOBO) as described by the manufacture. PCR primers used here were as follows. GAPDH: 5′-TGCACCACCAACTGCTTAG-3′ (sense), 5′-GATGCAGGGATGATGTTC-3′ (antisense); p38: 5′-ACAAACCAAGTCATCAAGG-3′ (sense), 5′-ATCAGAAGGAACCACACT-3′ (antisense); IL6: 5′-AACGATGATGCACTTGCAGA-3′ (sense), 5′-GAGCATTGGAAATTGGGGTA-3′ (antisense). Amplification was performed by denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec. GAPDH was performed on each experimental sample as an endogenous control. The real-time RT-PCR was carried out in a Bio-rad IQ 5 Multicolor real-time RT-PCR system and their software was used to calculate the cycle threshold of each reaction. All reactions were run in triplicate.
7
Real-Time RT-PCR Analysis of ANO1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from PKD1 RC/RC mouse, human kidney samples, transfected MDCK cells and PKD1 +/-cells.
The synthesis of cDNA was performed routinely by using the M-MLV Reverse Transcription system (Invitrogen Life Technologies, Darmstadt, Germany). Real-time RT-PCR was performed in a plate reader Light Cycler 480 by using a SYBR Green I (BioRad, USA) and a specific primer. The housekeeping gene GAPDH served as an internal control to estimate the relative quantity of mRNA expression and correct for differences in sample content. The following are primers used in this study: Human ANO1 primer sequences Forward, CAGCATGGAGAT-GTGTGACC; Reverse, CATCTGTTTCCGCTTCCAGT; Mouse ANO1 primer sequences Forward, GAAGCAA-CACCTATTCGACCTG; Reverse, TCCGTAACTTGCC-CATTCCTC; Canis lupus ANO1 primer sequences Forward, AAAAGCAAAGAGAAGCGCCG; Reverse, GC-CATGGCTGTCTTAACCCT.
The synthesis of cDNA was performed routinely by using the M-MLV Reverse Transcription system (Invitrogen Life Technologies, Darmstadt, Germany). Real-time RT-PCR was performed in a plate reader Light Cycler 480 by using a SYBR Green I (BioRad, USA) and a specific primer. The housekeeping gene GAPDH served as an internal control to estimate the relative quantity of mRNA expression and correct for differences in sample content. The following are primers used in this study: Human ANO1 primer sequences Forward, CAGCATGGAGAT-GTGTGACC; Reverse, CATCTGTTTCCGCTTCCAGT; Mouse ANO1 primer sequences Forward, GAAGCAA-CACCTATTCGACCTG; Reverse, TCCGTAACTTGCC-CATTCCTC; Canis lupus ANO1 primer sequences Forward, AAAAGCAAAGAGAAGCGCCG; Reverse, GC-CATGGCTGTCTTAACCCT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!