The total DNA of primary hepatocytes was extracted using the Multisource Genomic DNA Miniprep Kit (Axygen) according to the manufacturer's instructions. Quantitative real-time PCR analysis of mtDNA copy number in hepatocytes was performed using mitochondrion-encoded reduced nicotinamide adenine dinucleotide dehydrogenase 1 as the mtDNA marker and cyclophilin A as a genomic DNA marker. The primer pairs used in the PCR analysis are shown in Table 1 .
Multisource genomic dna miniprep kit
Manufactured by Corning
Sourced in United States
The Multisource Genomic DNA Miniprep Kit is a laboratory equipment product designed for the rapid and efficient extraction of high-quality genomic DNA from a variety of sample sources. The kit provides a streamlined protocol and necessary reagents to facilitate the isolation of DNA, which is a fundamental component in various genomic and molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Cpgenome dna modification kit, by Merck Group (2 mentions)
Dna gel extraction kit, by Corning (1 mentions)
Sybr green master mix, by Vazyme (1 mentions)
Pmd19 t vector, by Takara Bio (1 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Transstart green qpcr supermix, by Transgene (1 mentions)
Peasy t3 vector, by Transgene (1 mentions)
Jetprime reagent, by Polyplus Transfection (1 mentions)
T7 endonuclease 1, by New England Biolabs (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
14 protocols using multisource genomic dna miniprep kit
1
Quantifying Mitochondrial DNA in Hepatocytes
2
Genomic DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First, genomic DNA was extracted from cells with the Multisource Genomic DNA Miniprep Kit (Axygen), and then amplified by PCR with forward primer 5,TCTTCTTCATCATCCTCCTG 3, and reverse primer 5, GTTTGGCAATGTGCTTTT 3,. The PCR products were resolved in 1.7% agarose gel. Target bands were cut and purified with DNA Gel Extraction Kit (Axygen), and cloned into TA vector (CloneJET PCR cloning Kit, Ferments). After TA vector transformation into DH5α E.coli and incubation at 37°C overnight, we picked and sequenced several bacterium colonies.
3
Quantifying P. liquidambari Biomass in Infected Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
P. liquidambari-infected roots and shoots were harvested at 0, 3, 7, 14, 21, and 28 dai (days after inoculation). The biomass of P. liquidambari in the infected plant tissue was quantified using quantitative PCR (qPCR) according to Yang et al. (2014b (link)). DNA was extracted after grinding tissue powder with a Multisource Genomic DNA Miniprep Kit (Axygen). A primer set suitable for qPCR was designed based on a P. liquidambari-specific ITS locus (Bf1 and Br1) (Table S1 ). PCR amplified products were cloned into the pMD® 19-T vector (Takara, Otsu, Japan) and expressed in competent DH5αcells. Positive clones were screened and plasmids were extracted using a SanPrep Column Plasmid Mini-Prep Kit. A dilution range of the plasmids from 1.3 × 102 to 1.3 × 108 copies was used to make a standard curve. In the qPCR reaction system (20 μL), gDNA was mixed with SYBR® Green Master Mix (Vazyme, Nanjing, China), primers, and ddH2O. The PCR procedure was as follows: 94°C (1 min) for one cycle; 94°C (15 s), 60°C (45 s), and 72°C (30 s) for 45 cycles; melting curve analysis from 72 to 60°C in 0.5°C decrements. The amplification of a single PCR product was validated using 1.5% gel electrophoresis.
4
Telomere Length Quantification by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from tissues and cells with Multisource Genomic DNA miniprep kit (Axygen). For measuring telomere length, quantitative real-time PCR methods were used as previously described (Cawthon, 2009 (link); Min et al., 2018 (link)).
5
Methylation Profiling of Cancer Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Multisource Genomic DNA Miniprep kit (Axygen Scientific; Thermo Fisher Scientific, Inc.) was applied to extract total DNA from DLD-1 cells, according to the recommendations of manufacturer. A CpGenome™ DNA Modification kit (Chemicon; Merck KGaA) was employed to modify each genomic DNA from samples using sodium bisulfate according to the manufacturer's protocol. The methylation levels of MLH, phosphatase and tensin homolog (PTEN), runt-related transcription factor (RUNX), RASSF, cadherin-1 (CDH1), O-6-methylguanine-DNA-methyltransferase (MGMT) and P16 were determined. The regions of β-actin that were short of any CpG dinucleotide were amplified using a Cyclogene thermal cycler machine (Techne, Cambridge, UK): 65°C for 5 min, 96°C for 2 min, 65°C for 4 min, 96°C for 1 min, 65°C for 1 min, and 96°C for 30 sec. The primers used were as follows: MLH forward 5′-GGTTGGATATTTYGTATTTTTYGAG-3′ and reverse 5′-AATTACTAAATCTCTTCRTCCCTCC-3′; RUNX forward, 5′-CCTTACGTAGAGGTCACAGTAG-3′ and reverse 5′-CTCCAAGCTGCAAAGTCAC-3′; CDH1 forward, 5′-AATTTTAGGTTAGAGGGTTATCGCGT-3′ and reverse, 5′-TCCCCAAAACGAAACTAACGAC-3′; MGMT forward, 5′-GGGTTATTTGGTAAATTAAGGTATAGAG-3′ and reverse, 5′-CACCTAAAAATAAAACAAAAACTACCAC-3′; P16 forward, 5′-GAGGGGGTAGGGGGATAT-3′ and reverse, 5′-ACCAATCAACCAAAAACTCCATACTA-3′; β-actin forward, 5′-ACAGAGCCTCGCCTTTGC-3′ and reverse, 5′-GCGGCGATATCATCATCC-3′.
6
Quantitative RNA Expression Analysis in PFFs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA was extracted from PFFs according to the manufacturer’s introductions of Multisource Genomic DNA Miniprep Kit (Axygen, Shanghai, China). Total RNA was extracted from PFFs using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA concentration for each sample was quantified by NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA). The cDNAs from 1,000 ng of total RNA were obtained by PrimeScript RT reagent kit (TaKaRa, Dalian, China) according to the manufacturer’s introductions. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using TransStart Green qPCR SuperMix (Transgen Biotech, Beijing, China) according to the manufacturer’s introductions. The primers were synthesized by Genewiz (Genewiz, Jiangsu, China) (Table 1 ). Gene expression levels were normalized to the expression of β-actin using the comparative Ct (2−ΔΔCt) method.
7
Mutation Analysis via PCR and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For analysis of mutations, PCR fragments flanking the targeted sites were amplified with ABCB1 primers (SFB1-E3-4F: AGGGACAAACTCTTCATAACC, SFB1-E3-4R: TGGCAGCGTAAGACAGAA). The genomic DNA was extracted with a Multisource Genomic DNA Miniprep Kit (Axygen, New York, NY, USA) according to the manufacturer’s instructions. The PCR conditions were: 94 °C for 5 min, 34 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 35 s, followed by a final extension period of 72 °C for 10min. PCR amplicons were then analyzed via agarose gel electrophoresis. Direct sequencing of PCR products was conducted and double sequencing peaks, indicating a mutation event, were identified. PCR products were then recovered and cloned into pEASY-T3 Vector (TransGen, Beijing, China) and sequenced by Sangon Biotech (Shanghai, China).
8
Genomic DNA Extraction and Bisulfite Modification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted using a Multisource Genomic DNA Miniprep Kit (Axygen) according to the manufacturer's protocol. A 1 μg amount of genomic DNA from each sample was modified with sodium bisulfite using the CpGenomeTM DNA Modification Kit (Chemicon). β-actin was used to normalize DNA inputs; a region of β-actin devoid of any CpG dinucleotide was amplified. The primer sequences were listed in Supplementary Table S1 .
9
Identification of Mutant Insect Genotypes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To identify the mutations, a specific pair of primers (Cad-F: CCT CCT CAA ATA AGA TTA CC; Cad-R: ATG ATG GGC GCA TTG TCG T) were designed that flanked the target sites, and genomic DNA samples of individual insects were used as the template. The genomic DNA of the larvae was extracted using a Multisource Genomic DNA Miniprep Kit (Axygen, New York, NY, USA) according to the manufacturer’s instructions. The PCR conditions were as reported by Jin et al. [42 (link)]. Then, 10 µL PCR products were analyzed by agarose gel electrophoresis. Multiple bands indicated that double nicking had occurred. To analyze the exact type of mutation (insertion or deletion), the bands were recovered, cloned, and sequenced by Sangon Biotech (Shanghai, China).
10
Genomic DNA Extraction and Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from exuviates, larvae, and moths were extracted using the Multisource Genomic DNA Miniprep Kit (Axygen, New York, USA) according to the manufacturer’s recommendations. Detecting primers were designed flanking the CRISPR target sites (Primer-F: TAGCGGCTATGATTCAGAGACG; Primer-R: CTCTTTCGTCCAAGGGC CT). The PCR conditions were 94 °C for 5 min; 32 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 60 s; and 72 °C for 10 min. PCR products were directly sequenced and double sequencing peaks starting from the PAM sequences, which indicated a mutation event, were identified. PCR products were then cloned into the T3 Vector and sequenced by Sangon Biotech (Shanghai, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!