Primescrip rt pcr kit

The ERV1 gene was amplified by polymerase chain reaction (PCR) from complementary DNA (cDNA) of S. cerevisiae YPH499 using primers ERV1F1 and ERV1R1. The cDNA was prepared by reverse transcription PCR using a PrimeScrip RT-PCR Kit (Takara Bio, Otsu, Japan) from total RNA extracted from S. cerevisiae YPH499 cells using NucleoSpin RNA (Takara Bio). The PCR product was cloned between SphI and BamHI sites of pUC19 (Takara Bio). After the sequence was checked, the ERV1 gene was subcloned between NdeI and XhoI sites of pET-22b (Novagen) to give pET-ERV1. pET-ERV1 was used for Erv1 protein preparation. The plasmids for preparation of Erv1 variant proteins were constructed by inverse PCR using corresponding primer pairs and templates (Additional file 1: Table S1). For expression of ERV1 and its mutant genes in S. cerevisiae cells, the ERV1 gene was amplified by PCR from pET-ERV1 using primers ERV1F2 and ERV1R2. The PCR product was cloned between NheI and BamHI sites of pGK406 designed for target gene expression in S. cerevisiae [20 (link)]. The mutant genes coding Erv1 variants were also amplified by the same primer pairs and cloned into pGK406.

Total RNA was extracted from PANC-1, hTERT-HPNE, and PANC-1 cultured for 24 h after hypoxia using the anaerobic incubator. Reversely transcribed was performed using the PrimeScrip RT-PCR kit (Takara, Japan), and RT-qPCR was performed on a Roche instrument with SYBR PreMix Ex Taq (Takara, Japan). Primer sequences used in this study are shown as follows: PLAU forward: GGGAATGGTCACTTTTACCGAG, PLAU reverse: GGGCATGGTACGTTTGCTG; GAPDH Forward: GGAGCGAGATCCCTCCAAAAT, GAPDH Reverse: GGCTGTTGTCATACTTCTCATGG; PKM Forward CTGAAGGCAGTGATGTGGCC, PKM Reverse ACCCGGAGGTCCACGTCCTC; LDHA Forward GGCCTGTGCCATCAGTA: LDHA Reverse CAAGCCACGTAGGTCAA.

Total RNAs were extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA), reverse transcribed with PrimeScrip RT-PCR Kit (Takara Biotechnology Co., Ltd., Dalian, China), followed by qRT-PCR with SYBR Premix Ex Taq (Takara Biotechnology Co., Ltd., Dalian, China). QuantStudio 5 real-time PCR system (Applied Biosystems, Grand Island, NY) were used to examine the gene of interest mRNA expression. The amplification cycling conditions were 95 °C for 2 min; 40 cycles of 95 °C for 10 s, 60 °C for 40 s. Control of the RT reactions was performed by omitting DNA template in the negative controls. The data were analysed by comparative C_T method and three replicates were performed. The primers for KLRG1 were forward 5′-CCAGACCGCTGGATGAAATATG-3′ and reverse 5′-CTGATTGTCCGTTATCACAAGGA-3′. The primers for BTK were forward 5′- TCTGAAGCGATCCCAACAGAA-3′ and reverse 5′-TGCACGGTCAAGAGAAACAGG-3′. The primers for CCR2 were forward 5′-CCACATCTCGTTCTCGGTTTATC-3′ and reverse 5′-CAGGGAGCACCGTAATCATAATC-3′. The primers for SCML4 were forward 5′-TCACTCCACGCCTATGAAGAT-3′ and reverse 5′-GGGTTTCCGCCCTCTTTTC-3′. The primers for ACTB (Beta-Actin) were forward 5′-CTGTCCCTGTATGCCTCTG-3′ and reverse 5′-ATGTCACGCACGATTTCC-3′.
ACTB was used as an internal control.