Total RNA in tissues and cells were extracted using miRNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. cDNA was formed using miScript RT Kit (TaKaRa, Dalian, China). The quantitative PCR was performed using SYBR Premix Ex Taq II (TaKaRa) on ABI Prism 7700 Sequence Detection System (Thermo Fisher Scientific). The relative expression levels of LINC00152, Rab10 were normalized by glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and miR-107 was normalized by small nuclear RNA U6 and calculated with the method of 2−ΔΔCt. The primers were synthesized in Songon (Shanghai, China) and listed as follows: LINC00152: (Forward, 5ʹ-GAAGGTGTCGGCAAGATC-3ʹ and Reverse, 5ʹ-TCGGTGTCTGTCATATTCG-3ʹ), miR-107: (Forward, 5ʹ-AGCAGCATTGTACAGGG-3ʹ and Reverse, 5ʹ-GAATACCTCGGACCCTGC-3ʹ), Rab10: (Forward, 5ʹ-CACCGGATCGGGGATTCCGGAGTGG-3ʹ and Reverse, 5ʹ-AAACCCACTCCGGAATCCCCGATCC-3ʹ), U6: (Forward, 5ʹ-GCUUCGGCAGCACAUAUACUAAAAU-3ʹ and Reverse, 5ʹ-CGCUUCACGAAUUUGCGUGUCAU-3ʹ) and GAPDH: (Forward, 5ʹ-GGAGCGAGATCCCTCCAAAAT-3ʹ and Reverse, 5ʹ-GGCTGTTGTCATACTTCTCATGG-3ʹ).
Miscript rt kit
Manufactured by Takara Bio
Sourced in China
The MiScript RT Kit is a laboratory equipment product used for the reverse transcription of microRNA (miRNA) molecules into complementary DNA (cDNA). It provides the necessary reagents and enzymes to facilitate this process, enabling the downstream analysis and study of miRNA expression patterns.
Automatically generated - may contain errors
Lab products found in correlation
Sybr premix ex taq 2, by Takara Bio (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Mirneasy mini kit, by Qiagen (3 mentions)
C1000 thermal cycler, by Bio-Rad (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Abi prism 7700 sequence detection system, by Thermo Fisher Scientific (2 mentions)
Miscript sybr green pcr kit, by Qiagen (2 mentions)
Sybr green, by Takara Bio (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
Faststart universal sybr green master, by Roche (1 mentions)
Trizol, by Takara Bio (1 mentions)
Amv reverse transcriptase, by Solarbio (1 mentions)
Mirna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Triquick reagent, by Solarbio (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Sybr green kit, by Takara Bio (1 mentions)
Real time system, by Bio-Rad (1 mentions)
Random primer, by Takara Bio (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
14 protocols using miscript rt kit
1
Quantitative PCR Analysis of Gene Expression
2
Quantification of PVT1, BAMBI, and miR-17-5p in ESCLC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in ESCLC tissues or cells was extracted using miRNeasy Mini Kit (Qiagen, Valencia, CA, USA) and the reverse transcription was carried out using miScript RT Kit (TaKaRa, Dalian, China). The quantitative PCR was performed using FastStart Universal SYBR Green Master (Roche, Germany) on C1000 thermal cycler (Bio-Rad, Hercules, CA, USA). The levels of PTV1, BAMBI and miR-17-5p were normalized by glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or small nuclear RNA U6, respectively, and calculated by the 2−ΔΔCt method. The primers used in this program were synthesized in Beijing Genomics Institute (BGI, Shenzhen, China) and listed as follows: PVT1: (Forward, 5ʹ-TGAGAACTGTCCTTACGTGACC-3ʹ, Reverse, 5ʹ-AGAGCACCAAGACTGGCTCT-3ʹ), miR-17-5p: (Forward, 5ʹ-CCAGGATCCTTTATAGTTGTTAGAGTTT-3ʹ, Reverse, 5ʹ-CGGAATTCTAATCTACTTCACTATCTGCAC-3ʹ), BAMBI: (Forward, 5ʹ-CTCAAATTCCCCACTCACCCA-3ʹ, Reverse, 5ʹ-GCTGATACCTGTTTCCTTGTCCTG-3ʹ), GAPDH: (Forward, 5ʹ-TGTTCGTCATGGGTGTGAAC-3ʹ, Reverse, 5ʹ-ATGGCATGGACTGTGGTCAT-3ʹ) and U6: (Forward, 5ʹ-CTCGCTTCGGCAGCACA-3ʹ, Reverse, 5ʹ-AACGCTTCACGAATTTGCGT-3ʹ).
3
miRNA Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using Trizol (Invitrogen). Reverse transcription was performed using the miScript RT Kit (TaKaRa, Dalian, China). RT-qPCR was performed using miScript SYBR Green PCR Kit (Qiagen) on a C1000 thermal cycler (Bio-Rad, Hercules, CA). The primers of miR-1-3p and U6 were obtained from Qiagen (Qiagen). U6 was used as an internal control.
4
Quantifying miRNA Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using Trizol (Thermo Fisher Scientific). Reverse transcription was performed using the miScript RT Kit (TaKaRa, Dalian, People’s Republic of China). qRT-PCR was performed using miScript SYBR Green PCR Kit (Qiagen NV, Venlo, the Netherlands) on a C1000 thermal cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA). The primers of miR-10a-5p and U6 were obtained from Qiagen NV. U6 was used as an internal control.
5
Quantification of PDL RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from periodontal ligament (PDL) tissues and cells was extracted with the help of TRIzol (TaKaRa, Dalian, China). Immediately afterwards, reverse transcription (RT) was executed adhering to the instructions of the AMV Reverse Transcriptase (Solarbio, Beijing, China) and miScript RT Kit (TaKaRa). The quantitative real-time polymerase chain reaction (qRT-PCR) with cDNA as template was carried out exactly as described in the SYBR Green (TaKaRa) instructions, and information on the primers used in this procedure was listed in Supplement Table 1 . We normalized to the qRT-PCR data by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 small nuclear RNA (U6).
6
Profiling circRNA, miRNA, and mRNA in CRC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TriQuick Reagent (Solarbio), and the reverse transcription for circRNA/mRNA and miRNA was performed using miScript RT Kit (TaKaRa, Dalian, China) and a miRNA reverse transcription kit (Thermo Fisher Scientific), respectively. The qPCR was fulfilled using SYBR Premix Ex Taq II (TaKaRa), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and small nuclear RNA U6 were chosen as internal references for circRNA/mRNA and miRNA, respectively. The levels of hsa_circ_0000467, miR-383-5p, and SGK1 in CRC tissues and cells were analyzed with the method of 2−ΔΔCt. The oligonucleotides of primers were presented as follows: hsa_circ_0000467: (F, 5′-AATGGGACTTAAAAATGCGAGG-3′, and R, 5′-GTTGTGGACTACGTGGAGACT-3′), miR-383-5p: (5′-GGGAGATCAGAAGGTGATTGTGGCT-3′, and R, 5′-CAGTGCGTGTCGTGGAGT-3′), SGK1: (F, 5′-AGGATGGGTCTGAACGACTTT-3′, and R, 5′-TTTCCGATCACTTTCAAG-3′), GAPDH: (F, 5′-ACAGGGGAGGTGATAGCATT-3′, and R, 5′-GACCAAAAGCCTTCATACATCTC-3′), and U6: (F, 5′-ATTGGAACGATACAGAGAAGATT-3′, and R, 5′-GGAACGCTTCACGAATTTG-3′).
7
Colorectal Cancer CircRNA and miRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs were isolated from 60 paired samples and colorectal cancer cells using a trizol reagent (Sigma‐Aldrich). Next, the total RNA was reverse transcribed into complementary DNA using M‐MLV reverse transcriptase (Invitrogen) or miScript RT kit (Takara), and the SYBR Green kit (Takara) was used to conduct the qRT‐PCR assay. GAPDH and RNU6 (U6) were employed as the internal controls for the normalization of circRNA and miRNA expressions. The primer sequences were shown as follow: circ_0007385, F: 5′‐ATGTTTGAACGCATGTCTCTGC‐3′ and R: 5′‐CCGGGTAATAGACGGATCCAC‐3′; miR‐493‐3p, F: 5′‐GCCGAGTGAAGGTCTACTGTGT‐3′ and R: 5′‐CTCAACTGGTGTCGTGGA‐3′; RAB22A, F: 5′‐GTGTGTCTGCTCGGGGATAC‐3′ and R: 5′‐GCCCCTATTGTTGGGTTGATGT‐3′; GAPDH, F: 5′‐TCCCATCACCATCTTCCAGG‐3′ and R: 5′‐GATGACCCTTTTGGCTCCC‐3′; U6, F: 5′‐CTCGCTTCGGCAGCACATATACT‐3′ and R: 5′‐ACGCTTCACGAATTTGCGTGTC‐3′. Relative expressions were calculated with the 2‐△△Ct method.
8
Measuring RNA Stability and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to users' guidance, total RNA extraction was administered applying with TriZol reagent (Thermo Fisher Scientific). RNA content was monitored with NanoDrop 2000c (Thermo Fisher Scientific). Then we tweaked each pair of samples to obtain the same thickness. Reverse transcription of total RNA to cDNA using miScript RT Kit (TaKaRa). Afterwards, SYBR Premix Ex Taq II (TaKaRa) was employed for quantification detection. U6 and actin were implemented as internal references in this process. After completing the experiment using the FTC‐3000p qRT‐PCR system, the levels of concerned genes were calculated via the 2−ΔΔCt method. The primer list is shown in Table 1 . In addition, total RNA was added with Rnase (Sigma‐Aldrich) to react for 15 min and then RNA stabilities (circSEPT9 and linear SEPT9) were assessed through qRT‐PCR. Meanwhile, BC cells were supplemented with 2 mg/mL of actinomycin D for 4, 8, 12 and 24 h. At each time point, the relative RNA expression levels were monitored using qRT‐PCR.
9
Quantitative analysis of HOTAIR, KLF12, and miR-618 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA from MGC-803 and AGS cells was extracted using Trizol reagent (Thermo Fisher Scientific). After the detection of the concentration, the RNA samples were subjected to synthesize cDNA using miScript RT Kit (TaKaRa, Dalian, China). The quantitative PCR was performed using SYBR Premix Ex Taq II (TaKaRa) on a 96-well Real-Time system (Bio-Rad, Shanghai, China). The relative expression of HOTAIR, KLF12 and miR-618 was calculated by the method of 2−ΔΔCt and normalized by GAPDH or U6, respectively. The primers were synthesized in Beijing Genomics Institute (BGI, Shenzhen, China) and listed as follows: HOTAIR: (forward, 5ʹ-CAGTGGGGAACTCTGACTCG-3ʹ, reverse, 5ʹ-GTGCCTGGTGCTCTCTTACC-3ʹ); miR-618: (forward, 5ʹ-CGGCGGAAACTCTACTTGTCCTT-3ʹ, reverse, 5′-ATCCAGTGCAGGGTCCGAGG-3ʹ); KLF12: (forward, 5ʹ-CACCTGGAAATGTGAACAACA-3ʹ, reverse, 5ʹ-TTTTACTTTGTCTGGGAGATAGGC-3ʹ); GAPDH: (forward, 5ʹ-TGTTCGTCATGGGTGTGAAC-3ʹ, reverse, 5ʹ-ATGGCATGGACTGTGGTCAT-3ʹ) and U6: (forward, 5ʹ-CTCGCTTCGGCAGCACA-3ʹ, reverse, 5ʹ-AACGCTTCACGAATTTGCGT-3ʹ).
10
Quantitative Analysis of PCAT1, MTDH Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of RNA was carried out using a miScript RT Kit (TaKaRa, Dalian, China). Then random primers (TaKaRa) were utilized to synthesize cDNA. Quantitative PCR was performed using an SYBR Green PCR Master Mix (Applied Biosystems, Foster City, USA). The relative expression levels of PCAT1, MTDH were normalized with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and miR-363-3p was normalized with small nuclear RNA U6, and then calculated according to the 2−ΔΔCt method. The primers were obtained from Songon (Shanghai, China) and are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!