MiR-489 precursor sequences were amplified and linked to lentiviral vectors. Subsequently, lentivirus with miR-489 was packaged by using lentiviral packaging kit (Genechem Co. Ltd, Shanghai, China). For in vivo tumorigenesis assays, T-47D cells were infected with 1 × 106 units of lentivirus with miR-489 (or empty lentivirus acted as control). Then, 5 × 106 lentivirus-infected T-47D cells were subcutaneously injected into female BALB/c nude mice (4-5-week-old). 5-FU was given through intraperitoneal injection every three days (5 mg/kg) after xenografts reached 0.5 cm in diameter. Xenograft size was measured every 3 days and calculated based on the equation of 1/2 × length × width2. All mice were sacrificed on day 28 days. The animal care and experimental protocols were approved by the Animal Care Committee of The Fifth People’s Hospital of Wuxi, The Medical School of Jiangnan University.
Lentiviral packaging kit
Manufactured by Genechem
Sourced in China
The Lentiviral Packaging Kit is a laboratory tool designed to produce replication-incompetent lentiviral particles. It contains the necessary components, such as plasmids encoding the structural and packaging proteins, to facilitate the generation of lentiviral vectors. This kit provides the core function of lentiviral particle production for research applications.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (3 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Sirna targeting, by RiboBio (2 mentions)
Mimic control, by RiboBio (1 mentions)
Inhibitor control, by RiboBio (1 mentions)
Ribofect cp transfection kit, by RiboBio (1 mentions)
Blasticidin, by Thermo Fisher Scientific (1 mentions)
Hitransg a, by Genechem (1 mentions)
U87mg, by American Type Culture Collection (1 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Polybrene, by Merck Group (1 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Merck Group (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Gv112 lentivirus vector, by Genechem (1 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
21 protocols using lentiviral packaging kit
1
Overexpression of miR-489 Inhibits Breast Cancer Xenograft Growth
2
Lentivirus-Mediated miRNA Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A lentiviral packaging kit was purchased from GeneChem. A lentivirus carrying hsa-miR-346 or hsa-miR-negative control (miR-NC) was packaged in the human embryonic kidney cell line 293T. Virions were collected according to the manufacturer’s instructions. Stable cell lines were established by infecting U87 and U251 cells with lentiviruses, followed by puromycin selection.
3
Lentiviral and miRNA Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For stable transfection, lentiviruses carrying HOXC13-AS knockdown sequence (shHOXC13-AS) or control sequence (shCtrl) were packaged into LN229 and N3 cells via lentiviral packaging kit (Genechem Shanghai, China) according to manufacturer’s instructions and selected with puromycin at 2 days after transfection. For transient transfection, miR-122-5p mimics (miR-122-5p), control mimics, miR-122-5p inhibitor (anti-miR-122-5p) and inhibitor control were purchased from RiboBio (Guangzhou, China). SATB1 small interfering RNA (siSATB1), control siRNA (siCtrl), c-Myc siRNA (si-c-Myc) and control small interfering RNA (siRNA) (siCtrl) were bought from Genechem (Shanghai, China). RiboFECT CP Transfection Kit (Ribobio, Guangzhou, China) was employed for transient transfection according to manufacturer’s instructions. All sequences were listed in Table S1
4
Lentiviral Transduction of miR-1231
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral packaging kit were obtained from GeneChem (Shanghai, China). Next, the Lentivirus hsa-miR-1231 expression constructs and lentivirus hsa-negative control (miR-NC) were packaged in human embryonic kidney 293T cells according to the manufacturer’s protocol. Virions were collected from the medium supernatant. Stable cell lines were generated by infecting LN229, U251, and PG1 cells with lentivirus, followed by selection with blasticidin (Invitrogen, Carlsbad, CA).
5
Establishing CBX8-knockdown and CBX7-overexpression Glioma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A lentiviral packaging kit was purchased from GeneChem (Shanghai, China) to generate stable CBX8-knockdown (CBX8 siRNA) and CBX7-overexpression (CBX7 cDNA) glioma cell lines. According to the manufacturer's protocol, the hU6-MCS-CMV-EGFP lentiviral vectors encoding CBX8 small hairpin RNA (shRNA) or nontargeting shRNA were transfected with U87 and U251 glioma cells using HitransG A (REVG003, GeneChem, China). The cDNA of CBX7 was inserted into the lentiviral Ubi-MCS-3FL AG-CMV-EGFP vector that was sequentially transduced into the U87 and U251 cells (noncoding cDNA was set as control). CBX8-knockdown and CBX7-overexpression cell models were generated as described above. All the transfection efficiency was confirmed by fluorescence scanning and Western blot.
6
Lentiviral Transduction of U87 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviruses carrying shRNA-miR155HG or shRNA-ANXA2 and the negative control lentivirus (sh-miR155HG sequence is 5′-CUGGGAUGUUCAACCUUAATT-3′; sh-ANXA2 sequence is 5′- CGGGATGCTTTGAACATTGAA -3′; sh-NC sequence is 5′-UUCUCCGAACGUGUCACGUTT-3′) were assembled in the human embryonic kidney cell line 293 T, and the viruses were collected according to the manufacturer’s manual (Genechem). Stably transfected cell lines were established by infecting U87 cells with lentiviruses using a lentiviral packaging kit purchased from Genechem, followed by puromycin selection.
7
Lentiviral Transduction of Jurkat T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral packaging technology was used to construct a Jurkat T cell line with stable overexpression of ICOS. The lentiviral packaging kit was purchased from Shanghai Genechem Co., Ltd. T cells were seeded in a 24-well plate at a density of 105 cells/ml. The amount of virus and HiTransG P infection solution added to the culture was calculated according to the cell multiplicity of infection (MOI) and virus titer. The cells were centrifuged at 1,000 g for 60 min and cultured at 37 °C for 12–16 hours. Subsequently, the medium was changed and the cells were further expanded. At 72 hours after infection, 3 µg/mL of puromycin was added for selection. The infection rate measured by flow cytometry reached 97%. The concentration of puromycin was then reduced by half for further expansion. After selection, the stable overexpressing lines were confirmed by qPCR, western blot, and flow cytometry. The following primers were used: human GAPDH forward, GAGGTTTTGAGCGTTGAGGT, and reverse, GCAGGCTGTTGTCCGTCTTA; human ICOS forward, TGCAGCCTTTGTTGTAGTCTGC, and reverse, AGGGTCACATCTGTGAGTCTAG. The following antibodies were used: recombinant anti-GAPDH antibody (Abcam, ab181602), anti-ICOS antibody (Biorbyt, orb314633), HRP-conjugated goat anti-rabbit IgG (H+L) antibody (Invitrogen, 65-6120), and PE-conjugated mouse anti-human CD278 (BD, 557802). The data were analyzed with Prism7 and FlowJo7.6.
8
Notch3 Knockdown in Glioma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human glioma cell lines (U87MG, U251) were purchased from the American Type Culture Collection (Virginia, USA). The U87 and U251 glioma cell lines were incubated in 10% FBS DMEM mediums. A lentiviral packaging kit was purchased from GeneChem (Shanghai, China) to generate stable Notch3-knockdown (Notch3 shRNA) glioma cell lines. According to the manufacturer’s protocol, before we began the knockdown, the U251 and U87 were thawed and incubated at a concentration of 5*105 per well (six-well plate) overnight. The next day we changed the medium and added lentiviral vectors that encoded Notch3 small hairpin RNA (shNotch3) and nontargeting shRNA (shNT) to the medium for a 3-day infection. Finally, the U251 and U87 cell lines were harvested for protein extraction. Western blot was used to detect the knockdown efficiency of Notch3. Cell proliferation was determined by Ki-67staining. The primers for shNotch3 and shNT are provided in Supplementary Materials .
9
Synthetic miRNA Modulation of Six1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chemical synthesis of miR‐con and miR‐155‐3p mimic was carried out by Ribobio. Plasmid construct harbouring human Six1 was done as per instructions by Genechem. The cDNA of human Six1 was inserted in the pcDNA3 vector, and the recombinant plasmid pcDNA3‐Six1 was generated. Then, seeding was done (2 × 105 cells/well) in 6‐well plates containing complete medium with no antibiotic. After overnight growth, transfection of 100 nmol/L mature miRNA mimics and 7.5 μg plasmids was done for 72 hours into cells along with Lipofectamine 2000 (Invitrogen) as per instructions. The anti‐miR155‐3p or anti‐miR‐con (negative control, anti‐miR) harbouring lentivirus was packaged in 293T cells (human embryonic kidney cells) using the Genechem lentiviral packaging kit for two full days and harvested as per instructions. Transfection of U87 and A172 was done to generate stable cell lines by seeding cells (10 000 cells/well) in 24‐well plates for 24 hours, followed by transfection with lentivirus (0.5 μL; 1 × 108 TU/mL), and then selected on puromycin at 1 μg/mL.
10
Overexpression of VEGFA in Thyroid Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence of VEGFA (lacking 3′ untranslated region [UTR]) was amplified and cloned into pcDNA3.1 (Thermo Fisher Scientific) to generate the pcDNA3–VEGFA recombinant plasmid. The recombinant plasmid (10 µg) was transfected into TPC-1 cells using Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions. Lentivirus carrying miR-622 or negative control mimic (miR-NC) was packaged into HEK 293T cells using the lentiviral packaging kit (GeneChem, Shanghai, People’s Republic of China), according to the manufacturer’s manual. Stable cell lines were established by infection of TPC-1 with 0.5 µL lentivirus (1×108 TU/mL), followed by puromycin (1 µg/mL) selection.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!