Sanger sequencing was used to confirm presence of variants identified through clinical studies. The variants were amplified from the patients’ genomic DNA by polymerase chain reaction (PCR) and the products were sequenced directly. First-strand cDNA synthesis (Superscript III, Invitrogen), reverse-transcription (RT)-PCR, and Topo cloning (Thermo Fisher Scientific) allowed for the segregation of the variant alleles. PCR and sequencing primers are indicated in Supplemental Table S2 .
Topo cloning
Manufactured by Thermo Fisher Scientific
Sourced in United States
TOPO cloning is a fast and efficient method for the direct insertion of PCR products into plasmid vectors. It utilizes the topoisomerase I enzyme from Vaccinia virus to facilitate the ligation of PCR amplified DNA fragments into a vector, eliminating the need for traditional restriction enzyme-based cloning.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Gateway cloning, by Thermo Fisher Scientific (2 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions)
Gateway lr reaction, by Thermo Fisher Scientific (2 mentions)
Human hotair cdna, by Addgene (2 mentions)
Pcdna3.1 vector, by Addgene (2 mentions)
Accustart 2 pcr supermix, by Quantabio (2 mentions)
Pentr d topo, by Thermo Fisher Scientific (2 mentions)
Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (2 mentions)
Quickextract dna extraction solution, by Illumina (2 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Fugene6 hd transfection reagent, by Promega (1 mentions)
Interferrin, by Polyplus Transfection (1 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)
Quikchange xl site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Pcr4blunt topo vector, by Thermo Fisher Scientific (1 mentions)
Faststart essential dna green master kit, by Roche (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Sanger sequencing, by Eurofins (1 mentions)
47 protocols using topo cloning
1
Confirmation of Genetic Variants by Sanger Sequencing
2
Construction of Mutant Strains by Allelic Exchange
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Deletions of mutant strains were constructed by a two-step allelic exchange method using POR3 as the parental strain, as previously described (51 (link)). Briefly, approximately 400-to-500-nucleotide fragments of DNA regions upstream and downstream of the targeted gene were amplified by PCR using the primers listed in Table S1 in the supplemental material. Primers 2 and 3 contained a 15-to-18-bp overlapped site to connect the 3′ end of the upstream fragment with the 5′ end of the downstream fragment. Two amplified DNA fragments were conjoined by the second round of overlapping PCR using primers 1 and 4. The amplified fragment was cloned by the use of blunt end TOPO cloning (Thermo Fisher Scientific) and propagated in E. coli DH5α. The inserted fragment containing a deletion cassette was excised by restriction digestion with BamHI and PstI and subcloned into the suicide vector pYAK1. The constructed plasmid was introduced into E. coli strain SM10λpir and was mobilized into the V. parahaemolyticus POR3 strain by conjugation. The crossing-over colonies were selected by counterselection on 10% thiosulfate-citrate-bile salts-sucrose (TCBS). Isolates with a deletion allele were confirmed by PCR and sequencing.
3
Protease silencing and expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genes were silenced using siRNAs obtained from Qiagen targeting (all 5′ to 3′): ZDHHC5: ACCACCATTGCCAGACTACAA, PC2: AAGGTTATGGTCAATCCCAAA, Furin: 1-CCCGAGGATGACGGCAAGACA and 8-TTCCCTGTCCCTCTAAAGCAA, PC7: CAGCAAGTACGGATTCATCAA, PC7: 1-TAGCTATGACCTCAACTCTAA and 8-CAGGAGCGCATCTCAATGGAA, and viral glycoprotein VSV-G (as negative control): ATTGAACAAACGAAACAAGGA. For Furin and PC7, two different siRNAs were used because one was outside the coding sequence for recomplementation purposes. Silencing was performed for 72–96 h using Lipofectamine RNAiMAX (Thermo Fisher Scientific 13778150) or INTERFERrin (Polyplus 409-10) following the manufacturer’s protocol. Silencing efficiency was checked via Western blot and qPCR.
Plasmids were constructed using Gateway cloning (Thermo Fisher Scientific) for PC2, PC7, and E-cadherin or TOPO cloning (Thermo Fisher Scientific) for Furin. PC-sensor plasmids were a gift from the Constam laboratory, Ecole Polytechnique Federale de Lausanne, Lausanne, Switzerland. Point mutations to change or insert residues were performed using QuikChange XL site-directed mutagenesis kit (Agilent Technologies) or Q5 Site-directed mutagenesis kit (New England Biolabs). Proteins were expressed in RPE-1 cells for 24–48 h using FuGENE 6 HD Transfection Reagent (Promega E2691) following the manufacturer’s protocol.
Plasmids were constructed using Gateway cloning (Thermo Fisher Scientific) for PC2, PC7, and E-cadherin or TOPO cloning (Thermo Fisher Scientific) for Furin. PC-sensor plasmids were a gift from the Constam laboratory, Ecole Polytechnique Federale de Lausanne, Lausanne, Switzerland. Point mutations to change or insert residues were performed using QuikChange XL site-directed mutagenesis kit (Agilent Technologies) or Q5 Site-directed mutagenesis kit (New England Biolabs). Proteins were expressed in RPE-1 cells for 24–48 h using FuGENE 6 HD Transfection Reagent (Promega E2691) following the manufacturer’s protocol.
4
Quantifying Bacterial DNA Circularization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
110900 was grown overnight and diluted to an OD600 of 0.05. Cultures were grown for 2 h at 37°C, at which point the cultures were either treated with antibiotics (oxacillin or mitomycin C, 0.5 μg/mL) or left untreated. After 1 h additional incubation at 37°C, 1 mL of culture was withdrawn, and chromosomal DNA was extracted using the DNeasy blood and tissue kit (Qiagen). The samples were normalized according to DNA concentration and diluted 1:5 before being used in qPCRs. qPCRs were set up using the FastStart Essential DNA Green master kit (Roche), using three different primer pairs: criF/circR (38-kb fragment circularization), arsF/circR (59-kb fragment circularization), and adsAF/adsAR (chromosomal reference). For primer sequences, see Table S2. Reactions were run on a LightCycler 96 instrument (Roche), and data were analyzed using the 2–ΔΔCT method (60 (link)). The PCR product sequences were confirmed by cloning the PCR products into the pCR4Blunt-TOPO vector by TOPO cloning (Thermo Fisher) and sequenced using the M13 reverse primer site by Sanger sequencing (Eurofins).
5
Cloning and Transgenic Mouse Generation of IKKα Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human IKKα cDNA sequence was amplified from human keratinocyte RNA and cloned in pCRII-TOPO using Topo-Cloning (ThermoFisher, MA, USA) using specific primers that also included restriction sites (HindIII in 5′ and NotI in 3′). For N-IKKα cloning, the primer also included an NLS (nuclear localization signal) (atggatcccaagaagaagaggaaggtg) in 5′. For C-IKKα, the internal NLS site was removed by directed mutagenesis using QuikChange II (Stratagene). All constructs were checked by sequencing. N-IKKα and C-IKKα constructs were then subcloned in the pK5 vector containing 5.2 Kb of the bovine K5 promoter and a rabbit β-globin intron (Figure 1A ) [36 (link)].
C-IKKα and N-IKKα mice were generated in FVB/N and B6D2F2 hybrid background respectively. N-IKKα mice were then crossed with FVB/N mice and used in the 6th generation onwards. Mice were genotyped by PCR analysis of tail genomic DNA using primers specific for the rabbit β-globin intron.
C-IKKα and N-IKKα mice were generated in FVB/N and B6D2F2 hybrid background respectively. N-IKKα mice were then crossed with FVB/N mice and used in the 6th generation onwards. Mice were genotyped by PCR analysis of tail genomic DNA using primers specific for the rabbit β-globin intron.
6
Recombinant V-antigens and OprF Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five recombinant V-antigens and recombinant P. aeruginosa OprF were constructed. Details on the PCR primers and cloning sites are listed in Table 1 Fig 1
7
Gateway Cloning of T3E Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the cloning of the T3E genes from Rps and Xcc was performed by BP gateway BP or TOPO cloning (Thermo Fisher Scientific, Waltham, MA, USA) to generate pENTRY plasmids, which were later transferred into the appropriate Y2H plasmids (Mukhtar et al., 2011 ) using the LR gateway reaction (Thermo Fisher Scientific). Table S5 contains all the PCR primers and final plasmid identities describing the collection of plasmids used in this study. Gene sequence information from Rps strain GMI1000 (GenBank accessions: NC_003295 and NC_003296) (Salanoubat et al., 2002 ) can be obtained from www.ralsto‐T3E.org (Sabbagh et al., 2019 ) and from the published genome of Xcc strain 8,004 (NC_007086) (Qian, 2005 ).
8
Molecular Cloning and Mutagenesis of Kv9.2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human Kv9.2 sequenced-verified cDNA was obtained from the Mammalian Gene Collection (Clone ID: 5199736)(GE Dharmacon, Lafayette, Co). The RNA source for the cDNA was from an anonymous pool of 6 male brains, age range 23–27 years old. The library was oligo-dT primed and directionally cloned into pCMV-SPORT6 vector. Human Kv9.2 was transferred and cloned from the pCMV-SPORT6 vector by TOPO® cloning (Thermofisher scientific, Waltham, MA) into the pBID-UAS Drosophila vector45 (link).
Site directed mutagenesis was used to generate mutant human Kv9.2, c.1137 T > A, (p.D379E) using the Quick-change II site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) from the human Kv9.2 sequenced-verified cDNA. Germ-line transformants were generated with PhiC31 integrase with Chromosome II attP40 landing site. Drosophila were maintained with standard conditions and food. Uas-hKv9.2 and uas-hKv9.2-D379E were crossed to Elav(c155)-Gal4 stock (Bloomington stock number-458) for pan-neural expression and pdf-Gal4, pdf-rfp for electrophysiological characterization29 (link),30 (link). Post-developmental effects utilized GAL80TS ro, restricting expression to adult neurons46 (link)–48 (link). For electrophysiological and circadian analysis, expression was restricted to the LNV clock neurons by use of pdf-Gal4 or throughout the clock system through tim-Gal4.
Site directed mutagenesis was used to generate mutant human Kv9.2, c.1137 T > A, (p.D379E) using the Quick-change II site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) from the human Kv9.2 sequenced-verified cDNA. Germ-line transformants were generated with PhiC31 integrase with Chromosome II attP40 landing site. Drosophila were maintained with standard conditions and food. Uas-hKv9.2 and uas-hKv9.2-D379E were crossed to Elav(c155)-Gal4 stock (Bloomington stock number-458) for pan-neural expression and pdf-Gal4, pdf-rfp for electrophysiological characterization29 (link),30 (link). Post-developmental effects utilized GAL80TS ro, restricting expression to adult neurons46 (link)–48 (link). For electrophysiological and circadian analysis, expression was restricted to the LNV clock neurons by use of pdf-Gal4 or throughout the clock system through tim-Gal4.
9
Doxycycline-inducible lentiviral IRF1 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Doxycycline-inducible lentiviral Gateway (Invitrogen) vector containing IRF1 was constructed by PCR amplification from verified cDNA clones (GenBank: NM_002198 ) (GeneCopoeia), and standard TOPO cloning (Invitrogen) techniques were used to generate entry clones. The IRF1 construct was transduced via calcium chloride transfection into HEK293T cells as previously described (al Yacoub et al., 2007 (link)). Media containing viral supernatant was collected, filtered, and used to infect ASC adipocytes. Infection efficiency was measured as compared by co-infection with a GFP lentiviral construct. Expression of IRF1 was induced by addition of doxycycline (1 μg/mL final) to the adipogenic medium.
10
Overexpression of HOTAIR in AGS cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To overexpress HOTAIR in AGS cell, we used human HOTAIR cDNA (Addgene, Plasmid #26110, Cambridge, MA, USA).18 (link) The HOTAIR cDNA was amplified using a PCR system, and the resulting product was inserted in the pcDNA3.1 vector (Addgene, Plasmid #47388) using TOPO cloning (Invitrogen) according to the manufacturer's protocol. The HOTAIR-expressing vector was sequenced and analyzed using Macrogen (Macrogeninc., Seoul, Korea). AGS cell was transfected with 1 ug pcDNA3.1-HOTAIR (pcDNA-HOTAIR) for 24 h using Lipofectamine 2000 (Invitrogen).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!