Universal pcr master mix 2

The quantitative comparison of polymerase chain reaction (qPCR) products was performed by real-time PCR. qPCR of miRNA (reaction mixture: 10.0 μL of 2 × Universal PCR Master Mix II [Applied Biosystems], 7.0 μL of distilled water, 1.0 μL of TaqMan MicroRNA assay, and 2.0 μL of reverse transcription product) was done with a CFX96™ Real-Time System (Bio-Rad) (at 95 °C for 10 min, followed by 45 cycles at 95 °C for 15 s and 60 °C for 1 min). qPCR of mRNA was performed according to the method described previously [10 (link)]. Primers used were as follows: HSPA1B, F-TGGACTGTTG GGACTCAAGG AC, R-GGAACGAAAC ACCCTTACAG TATCA; HSPA8, F-TGCTGCTGCT ATTGCTTACG, R-TCAATAGTGA GGATTGACAC ATCA; p21, F-GACTCTCAGG GTCGAAAACG, R-GGATTAGGGC TTCCTCTTGG; and GAPDH, F-CACCACCATG GAGAAGGC, R-GCTAAGCAGT TGGTGGTGCA.

MiR-25 expression levels quantification using the TaqMan MicroRNA Assays was performed to the manufacturer’s instructions. cDNA was reverse transcribed from total RNA using specific miR-25 primers (Applied Biosystems, Waltham, MA, USA). PCR products were amplified from cDNA samples using the TaqMan MicroRNA Assays and Universal PCR Master Mix II (Applied Biosystems, Waltham, MA, USA). The real-time PCR results were normalized against an endogenous control RNU6B (Applied Biosystems, Waltham, MA, USA).

To analyze the miR-1246 level in EVs, the EVs were collected from the CM of NECs (HMVEC) and tumor cells (A375 and A375SM cells) as described in the previous text. QIAZOL was mixed with the EV solution, and cel-miR-39 (Hokkaido System Science, Japan) was added (final concentration: 1 nM). Afterward, the total RNA was extracted as described in the previous text. The cells were seeded on six-well plates at 1 × 10⁵ cells/well to analyze the miR-1246 level. Then, 500 µL of QIAZOL was added to the cells, and the total RNA was extracted as described in the previous text. To analyze the miR-1246 level, real-time RT-PCR was conducted using TaqMan MicroRNA Assays (Applied Biosystems, CA, USA) and a Universal PCR Master Mix II (Applied Biosystems), according to the manufacturer’s instructions. The cycling conditions were done according to the manufacturer’s instructions, and the CFX Manager program (Bio-Rad) was used for analysis. The primers and probes were defined as miR-1246 (Assay ID: CSN1EFS). Cel-miR-39 (Assay ID: 000200; UCACCGGGUGUAAAUCAGCUUG) level was used as the external control and RNU6B (Assay ID; 001093; CGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTTT) was used as internal control.

To analyze the miR-570 level, real-time RT-PCR was conducted using TaqMan MicroRNA Assays (Applied Biosystems, CA, USA) and a Universal PCR Master Mix II (Applied Biosystems), according to the manufacturer’s instructions. The cycling conditions were done according to the manufacturer’s instructions. The primers and probes were defined as mir-570 (Assay ID: 002347). hsa-mir-16 (Assay ID: 000391; UAGCAGCACGUAAAUAUUGGCG) level was used as an internal control.