Magnetic nanoparticles coated with glucuronic acid from Chemicell GmbH (Germany) specified as “50-nm fluidMAG-ARA”; hematoxylin and eosin from Biovitrum (Russia); potassium hexacyanoferrate (II) trihydrate, hydrochloric acid, and formaldehyde from Sigma-Aldrich (USA); K3-EDTA test tubes from Guangzhou Improve Medical Instruments (China); ExtractRNA, CleanRNA Standard kit, MMLV kit, HS Taq DNA Polymerase, and SYBR Green I dye from Evrogen (Russia) were used in the experiments. All other chemicals were of analytical grade.
Sybr green 1 dye
Manufactured by Evrogen
SYBR Green I dye is a fluorescent dye used for detecting and quantifying DNA in various laboratory applications. It binds to double-stranded DNA, emitting a green fluorescent signal upon excitation, allowing for the detection and measurement of DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (4 mentions)
Extractrna, by Evrogen (3 mentions)
Qpcr mix hs sybr master mix, by Evrogen (2 mentions)
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Hematoxylin and eosin, by BioVitrum (1 mentions)
Mmlv kit, by Evrogen (1 mentions)
Cleanrna standard kit, by Evrogen (1 mentions)
Hs taq dna polymerase, by Evrogen (1 mentions)
Hydrochloric acid (hcl), by Merck Group (1 mentions)
Formaldehyde, by Merck Group (1 mentions)
Potassium hexacyanoferrate 2 trihydrate, by Merck Group (1 mentions)
Qpcrmix hs sybr mastermixes, by Evrogen (1 mentions)
Qiazol, by Qiagen (1 mentions)
Mmlv rt kit, by Evrogen (1 mentions)
5 protocols using sybr green 1 dye
1
Magnetic Nanoparticles for Biomedical Applications
2
Quantifying Gene Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using ExtractRNA (Evrogen, Russia), and the subsequent cDNA synthesis was performed using QuantiTect Reverse Transcription Kit (Qiagen, Germany). Quantitative RT-PCR was performed using an Applied Biosystems StepONE Plus Real-Time PCR System (Thermo Fisher Scientific, USA) and qPCR mix-HS SYBR master mix containing SYBR Green I dye (Evrogen, Russia). The mRNA levels of genes of interest were quantified via ΔΔCt Relative quantification method with GAPDH as a housekeeping reference target. Each reaction had three technical replicates, and only the sybr green master mix was used as a negative template control. Primer sequences are listed in Table 2 below.
Oligonucleotide sequence of primers used for qPCR.
| Gene name | Forward: 5’-3’ | Reverse: 5’-3’ |
|---|---|---|
| α-SMA | CTGAAGAGCATCCGACAC | AGCCTGAATAGCCACATACAT |
| HAS2 | AGGTCGGTGTGAACGGATTTG | GAGAGCCTCAGGATAACT |
| Hyal1 | AACAAGTACCAAGGAATCAT | GAGAGCCTCAGGATAACT |
| Col1a1 | CCGCAAAGAGAGTCTACATGTC | CTGACTTCAGGGATGTCTTC |
| GAPDH | ACCTGCCAAGTATGATGA | GGAGTTGCTGTTGAAGTC |
| Col3a1 | AACACGCAAGGCAATGAGAC | AAGCAAACAGGGGCCAATGTC |
| CCL2 | CTCTTCCTCCACCACCAT | CTCTCCAGCCTACTCATTG |
| HRG | ACAGAAAGCAAGCCCTAAAG | GCAGAATCCAAAGACCAGAGG |
3
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using ExtractRNA (Evrogen, Moscow, Russia). A measure of 1 μg RNA was reverse-transcribed to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany), and quantitative RT-PCR was performed using an Applied Biosystems StepONE Plus Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) and qPCR mix-HS SYBR master mix containing SYBR Green I dye (Evrogen, Moscow, Russia). The mRNA levels of genes of interest were quantified via the ΔΔCt relative quantification method proposed by [16 (link)], with GAPDH as a housekeeping reference target. A primer list is provided in the Supplementary Materials, Table S1 .
4
Quantifying Gene Expression in CD14+ Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from CD14++ cells using QIAZOL (Qiagen); the corresponding cDNA was synthesized by using the MMLV-RT kit (Evrogen, Russia). The polymerase chain reactions were set in triplicates with qPCRmix-HS SYBR master mixes containing Sybr Green I dye (Evrogen, Russia). The target-specific primers (Table S4 in Supplementary Materials ) were designed by using the Primer-BLAST tool (NCBI, USA) in accordance with the general rules and custom ordered from Evrogen. Expression was quantified by the threshold cycle (Ct) approach; the relative expression levels were evaluated via an algorithm proposed by M. Pfaffl with B2M as a housekeeping reference target54 (link).
5
Optimized PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After optimizing the conditions for annealing the primers, the PCR protocol was used: 3 min at 95 °C, then 45 cycles of the following stages: 30 s at 95 °C, 30 s at 60 °C, 30 s at 72 °C, and the final elongation at 72 °C for 2 min. The reaction was carried out using a standard set of reagents containing SYBR Green I dye (Evrogen, Moscow, Russia) in real time.
Analysis of the genes expression was performed by the ΔΔCt method using the LightCycler480 II v 1.5.1 software (Roche, Basel, Switzerland) [51 (link)]. The GAPDH gene was used as a reference.
Analysis of the genes expression was performed by the ΔΔCt method using the LightCycler480 II v 1.5.1 software (Roche, Basel, Switzerland) [51 (link)]. The GAPDH gene was used as a reference.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!