Log In Sign up
The largest database of trusted experimental protocols

Pgl3 luciferase backbone

Manufactured by Promega
Visit Supplier

The PGL3 luciferase backbone is a plasmid vector used for the expression of firefly luciferase in various cell types. It contains the firefly luciferase gene under the control of a promoter, allowing for the production of the luciferase enzyme in transfected cells.

Automatically generated - may contain errors

Lab products found in correlation

Lenticrispr v2 plasmid, by Addgene (2 mentions)

2 protocols using pgl3 luciferase backbone

1

Generation of RNF146 Promoter Luciferase Reporter

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The RNF146 promoter luciferase reporter construct (pGL3-RNF146-Luc) was generated by subcloning the PCR-amplified RNF146 promoter (−1941 bp~−1 bp from the transcription start site; amplified from genomic DNA extracted from SH-SY5Y cells) into the pGL3 luciferase backbone (Promega). The CRISPR-cas9 construct targeting human ERβ was generated by cloning the sgRNA sequence for ERβ (5′-CACCGTCTGCAGCGATTACGCATC-3′) into a lentiCRISPR-v2 plasmid (Addgene plasmid #52961). Construct integrity was validated by sequencing. pLKO-shRNA targeting RNF146 and pLKO-shRNA targeting dsRed constructs [8 (link)] were previously described.
Kim H., Park J., Leem H., Cho M., Yoon J.H., Maeng H.J, & Lee Y. (2019). Rhododendrin-Induced RNF146 Expression via Estrogen Receptor β Activation is Cytoprotective Against 6-OHDA-Induced Oxidative Stress. International Journal of Molecular Sciences, 20(7), 1772.
+ Open protocol
+ Expand
2

Constructing RNF146 Promoter Reporter and CRISPR-Cas9 Targets

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The RNF146 promoter luciferase reporter construct (pGL3-RNF146-Luc) was generated by subcloning the PCR-amplified RNF146 promoter (-1941 bp∼-1bp from the transcription start site; amplified from genomic DNA extracted from SH-SY5Y cells) into the pGL3 luciferase backbone (Promega). CRISPR-cas9 construct targeting human ERβ was generated by cloning sgRNA sequence for ERβ (CACCGTCTGCAGCGATTACGCATC) into lentiCRISPR-v2 plasmid (Addgene plasmid #52961). The construct integrity was validated by sequencing. pEGFP-C3-AIMP2 [11 (link)], pLKO-shRNA targeting RNF146, pLKO-shRNA targeting dsRed, pEGFP-C2-human RNF146, and pEGFP-C2 [6 (link)] have been previously described.
Kim H., Ham S., Lee J.Y., Jo A., Lee G.H., Lee Y.S., Cho M., Shin H.M., Kim D., Pletnikova O., Troncoso J.C., Shin J.H., Lee Y.I, & Lee Y. (2017). Estrogen receptor activation contributes to RNF146 expression and neuroprotection in Parkinson's disease models. Oncotarget, 8(63), 106721-106739.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!