Gibson assembly protocol

Nup42, Nup50, Nup54, Nup62, Nup88, Nup133 and Nup214 in the pDONR221 gateway master vector were purchased from DNASU and cloned into the cell=free expression vector pCellFree_03 (ref. ^{55 (link)}), using the Gateway method, to produce fusion proteins with an N-terminal GFP tag (see Supplementary Table 2 for details). Nup35, Nup58, Nup98, Nup358 and Pom121 were cloned from complementary DNA (cDNA) prepared from HEK293T cells. Briefly, RNA was extracted using an Isolate II RNA mini kit (Bioline), and cDNA was synthesized using oligo(dT) primers and SuperScript IV (Thermo Fisher Scientific). Target genes were then cloned into pCellFree_03 using the Gibson assembly protocol (New England Biolabs). Nup98 and Pom121 fragments were purchased as gBlocks from IDT and cloned into pCellFree_03. pET28a vectors containing mCherry2-Nup98 fragments, as well as pGEX-6P-3 vectors containing importin-α, TNPO1 and TNPO3 were purchased from GenScript. Cell lines (HEK239T) were only used for cDNA preparation in this study, with gene identity subsequently confirmed by Sanger sequencing.

We used the Gibson Assembly protocol from New England BioLabs (catalog no. E5510) to create the SLC22A24 p.Tyr501Ter construct by amplifying unique segments from the SLC22A24 wild type and pCMV6-Entry vectors. The following primers were used to amplify the segment containing SLC22A24 residues 1–500 from the SLC22A24 wild type plasmid:
The following primers were used to amplify the segment containing the linker, tag, stop codon, and the rest of the vector backbone from the pCMV6-Entry vector:
Each segment contains a 15 bp overhang necessary for the Gibson Assembly workflow. The amplified segments were then assembled following the manufacturer’s protocol (https://www.neb.com/protocols/2012/12/11/gibson-assembly-protocol-e5510).

DNA inserts bearing the human H1 promoter sequence (in bold) upstream either short hairpin luciferase (shluc) or vt1-2 (vt1-2) or small vt1-2 (svt1-2) sequences (bold) have been obtained by gBlock gene fragment synthesis (IDT) and subsequently cloned into a plasmid backbone via Gibson assembly protocol (New England Biolabs) following the manufacturer’s instructions. Recombinant plasmid sequences have been verified by Sanger sequencing:
(H1shluc)
GAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACAGATCCCCGGATTCCAATTCAGCGGGAGCCACCTGATGAAGCTTGACGGGTGGCTCTCGCTGAGTTGGAATCCATTTTT;
(H1vt1-2)
GAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACAGATCCCCGGGCTGGCTTTAGCTCAGCGGTTACTTCGAGTACATTGTAACCACCTCTCTGGGTGGTTCGAGACCCGCGGGTGCTTTCCAGCTCTTTTT; and
(H1svt1-2)
GAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACAGATCCCCCGCGGGTGCTTTCCAGCTCTTTTT.

Yeast histone expression plasmids were derived from the HHT1-HHF1 URA3 CEN ARS plasmid pMS329 (gift from Mitchell Smith, University of Virginia) and the HHT2-HHF2 TRP1 CEN ARS plasmid pWZ414-F12 (gift from Rolf Sternglanz, Stony Brook University) (26 (link), 57 (link)). The plasmid for hht1(R49C) (pEL649) was constructed by digesting pMS329 with ClaI and AgeI to remove a segment of the H3 gene, followed by recombination with a synthetic DNA fragment (Twist Bioscience) containing the R49C mutation, using the Gibson assembly protocol (New England Biolabs). The plasmids for hht2(R49C) (pEL629), hht2(V46C) (pEL651), hht2(A47C) (pEL652), and hht2(S102C) were similarly constructed by digesting pWZ414-F12 with BlpI and BamHI to remove the H3 fragment followed by recombination with the mutant sequences. The 2xV5-HHT1 (pEL656) and 2xV5-hht1(R49C) (pEL650) plasmids were generated by digesting pMS329 and pEL649, respectively, with AgeI and PmeI followed by recombination with a synthetic fragment containing the N-terminal 2xV5 tag. The hhf2(R92C) plasmid (pEL626) was generated by digesting pWZ414-F12 with BamHI and NcoI and replacing the H4 fragment with a synthetic DNA fragment containing the R92C mutation. The integrity of all plasmids was confirmed by Sanger sequencing (Genewiz).