Gotaq master mix 2

Bacteria- and fungi-derived DNA, were respectively evaluated by DNA amplification of a short fragment of the V1 region of the 16S rRNA (V1_F: 5′-AGAGTTTGATCMTGGCTCAG-3′ and V1_R: 5′-TTACTCACCCGTICGCCRCT-3′) or a portion of the 5.8S rRNA region (5.8S_F: 5′-CARCAAYGGATCTCTTGG-3′ and 5.8S_R: 5′-TGTGCGTTCAAAGATTCGAT-3′). To evaluate the human DNA levels, used to normalize human:fungi:bacteria ratios, we used ACTB primers (ACTB_F: 5′-CCATCTACGAGGGGTATGC-3′ and ACTB_R: 5′-GGTGAGGATCTTCATGAGGTA-3′) that amplify two targets in the human genome (chrms 5 and chrms 7), generating amplicons of similar lengths (88 and 92 nt). The qPCR mix for ACTB and 16S-V1 genes consisted of 0.2 μM of each primer, 5 μL of Fast SYBR Green 2× (ThermoFisher) and 3 μL of the eluted DNA in various concentrations, in a final volume of 10 μL. Cycling conditions consisted of an initial denaturation (95 °C for 20 s) followed by 40 cycles at 95 °C for 3 s and 60 °C for 30 s. For 5.8S gene fragment, the qPCR mix included 0.2 μM of each primer, 5 μL of the GoTaq Master Mix 2× (Promega, Madison, WIS, USA) and 4.2 μL of eluted DNA in a final volume of 10 μL. Cycling conditions for qPCR were initial denaturation at 95 °C for 3 min, followed by 40 cycles at 95 °C for 15 s and 58 °C for 30 s. All experiments were conducted in duplicates and qPCR was performed in a 7500 Real-Time PCR System (ThermoFisher).

Yeast isolates identified as Debaryomyces spp. were identified as D. hansenii using the species-specific primers reported by [47 (link)]. These primers amplified a putative PAD1 gene homologous region (729 bp). PCR was performed on DNA extracted from the yeast isolates using the primers DhPadF 5′ GCGACTATGAACAGGTTTCCAACGA 3′ and DhPadR 5′CCTTCAATGTAACATCAGCGGCCC 3′. The amplification reaction was performed in a total volume of 10 µL containing 1 µL of yeast DNA (100 ng µL⁻¹), 2 µL of nuclease-free water, 5 µL of GoTaq Master Mix 2× (Promega Corporation, USA), and 1 µL of each primer (10 µM). The thermal cycler (TProfessional Basic Gradient, Biometra Analytic Jena GmbH, Germany) was operated under the following amplification conditions: initial denaturation at 94 °C for 5 min, followed by 39 cycles consisting of 30 s at 94 °C, 30 s at 55 °C, 1 min at 72 °C, and a final extension of 10 min at 72 °C. PCR products were separated on a 1% agarose gel using 1× TAE buffer at 80 V for 30 min. The size of the amplification products was determined by comparison with a 100 bp DNA ladder (Invitrogen™, Thermo Scientific™, Waltham, MA, USA).