Log In Sign up
The largest database of trusted experimental protocols

Control shrna shc002

Manufactured by Merck Group
Visit Supplier

Control shRNA (SHC002) is a short hairpin RNA (shRNA) construct that serves as a negative control for shRNA-mediated gene knockdown experiments. It is designed to not target any known genes in the human, mouse, or rat genome.

Automatically generated - may contain errors

Lab products found in correlation

Turbofect, by Thermo Fisher Scientific (4 mentions) Penicillin, by GE Healthcare (2 mentions) Streptomycin, by GE Healthcare (2 mentions) Cosmic serum, by GE Healthcare (2 mentions) Lenti x 293t cells, by Takara Bio (2 mentions) Plenti cmv v5 luciferase, by Addgene (2 mentions) Lenti x 293t, by GE Healthcare (2 mentions) Granulocyte stem cell factor, by GoldBio (2 mentions) Txnrd1 shrna, by Merck Group (2 mentions) Plv crispr hcas9 t2a puro u6 htxnrd, by VectorBuilder (2 mentions) Shrna2, by Merck Group (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

MISSION® pLKO.1-puro Non-Mammalian shRNA Control Plasmid (SHC002) MISSION pLKO.1-puro Non-Mammalian shRNA Control (SHC002; MISSION non-target shRNA control vector (SHC002) Control shRNA SHC002

4 protocols using control shrna shc002

1

Targeted Knockdown of Key Neuroprotective Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
pLKO vectors expressing shRNAs targeting the mRNA sequences of human NMNAT2 (shRNA1: TRCN0000035439, shRNA2: TRCN0000035440), NMNAT1 (TRCN0000111436), PARP16 (shRNA1: TRCN0000433598, shRNA2: TRCN0000053169), and control shRNA (SHC002) were purchased from Sigma.
Dox-inducible shRNA knockdown of NMNAT2 in SH-SY5Y cells were described previously (Ryu et al., 2018 ). The pTRIPZ vectors encoding shRNAs targeting human NMNAT2 were purchased from Dharmacon (shRNA1: V3THS400730, shRNA2: V3THS_400733) and the control pTRIPZ vector was used as described previously (Ryu et al., 2018 ). The pTRIPZ vector encoding shRNAs targeting human RPL24 was purchased from Horizon Discovery (RHS4696-200748120).
Challa S., Khulpateea B.R., Nandu T., Camacho C.V., Ryu K.W., Chen H., Peng Y., Lea J.S, & Lee Kraus W. (2021). Ribosome ADP-Ribosylation Inhibits Translation and Maintains Proteostasis in Cancers. Cell, 184(17), 4531-4546.e26.
+ Open protocol
+ Expand
2

Characterizing AML cell lines and patient samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lenti-X 293T cells were purchased from Clontech. Lenti-X 293T and AML cell lines (HL60, OCIAML3, THP-1, MOLM13, MV411) were maintained in RPMI media supplemented with 10% cosmic serum (GE Healthcare) and 100U/ml Penicillin with 100μg/ml Streptomycin (GE Healthcare). MV411-luciferase cells were generated by stably transfecting MV411 cells using the plasmid pLenti-CMV V5-luciferase (Addgene). Patient samples were obtained from Hematopoietic biorepository and cellular therapy core at Case Western Reserve University. All work on human patient samples were approved by Institutional Review Board at University Hospitals Cleveland Medical Center. All patient samples were derived from bone marrow, had >60% leukemic blasts, and underwent ficoll purification to isolate mononuclear cells prior to testing. Primary leukemic cells were cultured in IMDM media (GE Healthcare) with 20% serum supplemented with 20ng/ml Granulocyte Stem cell factor (Gold Biotechnology). Transient transfections were performed using Turbofect (ThemoFisher Scientific) following manufacturer’s protocols. Stable transfections were obtained by using shRNA constructs - Control shRNA (SHC002) and TXNRD1 shRNA (TRCN0000046533 (#1) and TRCN0000046535 (#2)) from Sigma as well as the CRISPR construct pLV[CRISPR]-hCas9:T2A:Puro-U6>hTXNRD with the following guide sequence TATGTCGCTTTGGAGTGCGC from VectorBuilder.
Karunanithi S., Liu R., Hou Y., Gonzalez G., Oldford N., Roe A.J., Idipilly N., Gupta K., Amara C.S., Putluri S., Lee G.K., Valentin-Goyco J., Stetson L., Moreton S.A., Putluri V., Kavuri S.M., Saunthararajah Y., de Lima M., Tochtrop G.P., Putluri N, & Wald D.N. (2021). Thioredoxin Reductase is a major regulator of metabolism in leukemia cells. Oncogene, 40(33), 5236-5246.
+ Open protocol
+ Expand
3

PTEN Knockdown via shRNA Lentiviral System

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short hairpin RNA (shRNA) targeting Pten 3′-UTR were designed and cloned according to the instructions provided for the lentiviral pLKO.1-TRC cloning vector. Control shRNA (shc002), shRNAs targeting the coding sequence (CDS; sh931 and sh1159), and shRNA2512 were obtained from Sigma. Sequences of all shRNAs targeting Pten 3′-UTR are listed in Supplementary Table S7. For lentivirus production, HEK 293T cells were co-transfected with 4 μg of shRNA construct and 2 μg of each lentiviral packaging vectors pMD2.G and psPax2 using Lipofectamine 2000 (Invitrogen). Lentiviral particles were collected 36 and 60 h post-transfection, mixed together and filter sterilized. For cell infection, NMuMG and NIH3T3 were plated at 50–70% confluency in 6-well plates and infected with 1 ml of lentiviral preparations supplemented with polybrene at 4 μg/ml. Cells were selected with 1.5 μg/ml (NMuMG) or 2 μg/ml (NIH3T3) of puromycin for 7 days or longer and collected for RNA and protein analyses.
Thivierge C., Tseng H.W., Mayya V.K., Lussier C., Gravel S.P, & Duchaine T.F. (2018). Alternative polyadenylation confers Pten mRNAs stability and resistance to microRNAs. Nucleic Acids Research, 46(19), 10340-10352.
+ Open protocol
+ Expand
4

Characterizing AML cell lines and patient samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lenti-X 293T cells were purchased from Clontech. Lenti-X 293T and AML cell lines (HL60, OCIAML3, THP-1, MOLM13, MV411) were maintained in RPMI media supplemented with 10% cosmic serum (GE Healthcare) and 100U/ml Penicillin with 100μg/ml Streptomycin (GE Healthcare). MV411-luciferase cells were generated by stably transfecting MV411 cells using the plasmid pLenti-CMV V5-luciferase (Addgene). Patient samples were obtained from Hematopoietic biorepository and cellular therapy core at Case Western Reserve University. All work on human patient samples were approved by Institutional Review Board at University Hospitals Cleveland Medical Center. All patient samples were derived from bone marrow, had >60% leukemic blasts, and underwent ficoll purification to isolate mononuclear cells prior to testing. Primary leukemic cells were cultured in IMDM media (GE Healthcare) with 20% serum supplemented with 20ng/ml Granulocyte Stem cell factor (Gold Biotechnology). Transient transfections were performed using Turbofect (ThemoFisher Scientific) following manufacturer’s protocols. Stable transfections were obtained by using shRNA constructs - Control shRNA (SHC002) and TXNRD1 shRNA (TRCN0000046533 (#1) and TRCN0000046535 (#2)) from Sigma as well as the CRISPR construct pLV[CRISPR]-hCas9:T2A:Puro-U6>hTXNRD with the following guide sequence TATGTCGCTTTGGAGTGCGC from VectorBuilder.
Karunanithi S., Liu R., Hou Y., Gonzalez G., Oldford N., Roe A.J., Idipilly N., Gupta K., Amara C.S., Putluri S., Lee G.K., Valentin-Goyco J., Stetson L., Moreton S.A., Putluri V., Kavuri S.M., Saunthararajah Y., de Lima M., Tochtrop G.P., Putluri N, & Wald D.N. (2021). Thioredoxin Reductase is a major regulator of metabolism in leukemia cells. Oncogene, 40(33), 5236-5246.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!