Total tissue RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and sample concentration and purity verified through standard methods. Analysis of miR-155 expression was performed using a Hairpin-it qRT-PCR kit (GenePharma, Shanghai, China) according to the manufacturer’s instructions using U6 snRNA as internal control. TLR3 expression was assayed with a SYBR Green PCR kit (GenePharma) with GAPDH as internal control. Reactions containing neither reverse transcriptase nor template were used as negative controls. PCR reactions were carried out on an Applied Biosystems 7500 Real-Time PCR system. Each assay was repeated 3 times. Relative gene expression was quantified by the 2-ΔΔCT method. Convergent primers were used to detect mRNAs and stem-loop RT primers were used to detect miR-155. Primer sequences are shown in Supplementary Table 2 .
Sybr green pcr kit
Manufactured by GenePharma
Sourced in China
The SYBR Green PCR kit is a reagent used for real-time polymerase chain reaction (PCR) amplification and detection of DNA sequences. It contains SYBR Green I dye, which binds to double-stranded DNA and emits fluorescence, allowing for the quantification of the amplified DNA during the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Hairpin it qrt pcr kit, by GenePharma (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol total rna extraction kit, by Takara Bio (1 mentions)
Cdna synthesis kit, by GeneCopoeia (1 mentions)
Superscript reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Oligo dt 18 primer, by Thermo Fisher Scientific (1 mentions)
6 protocols using sybr green pcr kit
1
Quantitative Analysis of miR-155 and TLR3 Expression
2
Quantification of miR-338-5p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells or tissues by using the Trizol total RNA extraction kit (TaKaRa, Japan). For the detection of miR-338-5p expression, total RNA was reverse-transcribed with a miR-338-5p specific RT primer (GenePharma, China) and microRNA Reverse Transcription Kit (GenePharma, China). amplified with cDNA amplification primers (GenePharma, China). The SYBR Green PCR kit (GenePharma, China) was used for qRT–PCR according to the manufacturer’s protocols. All following primer sequences were list in Table S2
3
Comprehensive RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from samples specimens or cells was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Reverse‐transcribed was performed with cDNA Synthesis Kit (GeneCopoeia Inc., Rockville, MD, USA) following the manufacturer's information. Quantitative real‐time reverse transcription‐PCR (qRT‐PCR) was carried out to determine the expression level of miRNA and LncRNA expression using SYBR‐green PCR kit (GenePharma, Shanghai, China) on PRISM 7900HT system. GAPDH or U6 snRNA was performed to as normalization control and the expression was determined with 2‐DDCT method. qRT‐PCR primers were listed as following: RMRP Forward: 5′‐ACTCCAAAGTCCGCCAAGA‐3′′ and 5′‐GTAACTAGA−GGGAGCTGAC‐3′; GADPH: Forward: 5′‐GTCAA‐CGGATTTGGTCTGTATT‐3′′ and 5′‐AGTCTTCTGGGTGGCAGTGAT‐3′.
4
Quantifying miR-181a-3p and NF-κB Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from blood cells using TRIzol (Invitrogen). Reverse transcription and quantitative real-time PCR (RT-qPCR) for gene expression were performed using the SYBR Green PCR Kit (GenePharma, shanghai, PR China). The primer sequences were as follows. MiR-181-a-3p forward (5′-3′): AGAATTACACCATCGACCGTTG; MiRNA-181-a-3p reverse (5′-3′): TATGCTTGTTCTCGTCTCTGTGTC. U6 forward (5′-3′): ATTGGAACGATACAGAGAAGATT; U6 reverse (5′-3′): GGAACGCTTCACGAATTTG. NF-κB forward (5′-3′): CTGAACCAGGGCATACCTGT; NF-κB reverse (5′-3′): GAGAAGTCCATGTCCGCAAT. NEMO/IKBKG forward (5′-3′): TACTGGGCGAAGAGTCTCC; NEMO/IKBKG reverse (5′-3′): AGAATCTGGTTGCTCTGCC. Analysis of relative gene expression was using 2−ΔΔCT method.
5
Quantifying HOXA9 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cell lines and human BM specimens were extracted using the Trizol (Invitrogen). Reverse transcription and quantitative real-time PCR for determination of HOXA9 and GAPDH mRNA expression were performed using the SYBR Green PCR Kit (GenePharma, shanghai, PR China). The primer sequences of HOXA9 was as follows: HOXA9 forward: 5′-CACCAGACGAACAGTGAGGA-3′; reverse (5'-3'): TGGTCAGTAGGCCTTGAGGT. Analysis of relative mRNA expression was using 2-△△CT method.
6
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total-RNA was extracted from AVPNs using TRIzol (Invitrogen, Carlsbad, CA, USA), Superscript TM Reverse transcriptase and oligo(dt) 18 primer were employed for cDNA synthesis following the manufacturer's guidances (Life Technologies, Gaithersburg, MD, USA). Real-time PCR reactions were performed using a SYBR Green PCR kit (GenePharma, Shanghai, China). GAPDH was used as the internal control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!