Caveolin 1 sirna

Manufactured by Santa Cruz Biotechnology

Sourced in United Kingdom, United States

Caveolin-1 siRNA is a laboratory tool designed to temporarily reduce the expression of the caveolin-1 gene. It is a small interfering RNA (siRNA) that can be used to study the function of caveolin-1 in cellular processes.

Automatically generated - may contain errors

Lab products found in correlation

Dynasore, by Bio-Techne (1 mentions) Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (1 mentions) Sc 44237, by Santa Cruz Biotechnology (1 mentions) Ampkα1 2 sirna, by Santa Cruz Biotechnology (1 mentions) Hyperfect transfection reagent, by Qiagen (1 mentions) Aicar, by Selleck Chemicals (1 mentions)

Close spelling variants of this product

SiRNAs (95 citations) Caveolin-1 (35 citations)

3 protocols using caveolin 1 sirna

Synuclein Uptake in Cultured Neurons

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ATTO-550-labeled α-synuclein monomers and fibrils were prepared as previously described [23 (link)]. Cultured neurons were either treated or not treated with 1 μM ATTO-550-labeled α-synuclein monomers or fibrils for 48 h. To examine the dependency on caveolae in the process of α-synuclein uptake, dopaminergic neurons were exposed to 50 μM dynasore [24 (link)] (Tocris Bioscience, Bristol, United Kingdom) or 3.3 nM caveolin-1 siRNA (#sc-29942; Santa Cruz Biotechnology, Dallas, TX, USA).

Kawahata I., Sekimori T., Wang H., Wang Y., Sasaoka T., Bousset L., Melki R., Mizobata T., Kawata Y, & Fukunaga K. (2021). Dopamine D2 Long Receptors Are Critical for Caveolae-Mediated α-Synuclein Uptake in Cultured Dopaminergic Neurons. Biomedicines, 9(1), 49.

+ Open protocol

+ Expand

Caveolin-1 Silencing in HRT-18G Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HRT-18G cells were transfected with 25 pmol of caveolin-1 siRNA (sc-29241, Santa Cruz Biotechnology) or scrambled negative control siRNA (sc-44237, Santa Cruz Biotechnology) using lipofectamine RNAiMAX reagent (Thermo Scientific) according to manufacturer’s protocol. Two consecutive transfections were performed 24 h and 48 h after cell seeding. Subsequently, cells were infected and prepared for imaging.

Szczepanski A., Owczarek K., Milewska A., Baster Z., Rajfur Z., Mitchell J.A, & Pyrc K. (2018). Canine respiratory coronavirus employs caveolin-1-mediated pathway for internalization to HRT-18G cells. Veterinary Research, 49, 55.

+ Open protocol

+ Expand

Regulation of HUVEC Function by siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

HUVECs grown to confluence in 40%∼50% were transfected with 20 nM cavin-1 siRNA (GGAGGTTGAGGAGGTTATT), caveolin-1 siRNA(AACGAGAAGCAAGTGTACGAC) or AMPK α1/2 siRNA (Santa Cruz Biotech-nology, CA, USA) using Hyperfect transfection reagent (Qiagen, Hilden, Germany). siRNAs were synthesized by RIBOBIO (Guangzhou, China). To evaluate the effect of NO, L-NAME at the concentration of 50 μM was added at the beginning of siRNA transfection, Complete medium containing 50 μM L-NAME was replenished every 24 h. AICAR (Selleckchem, Houston, TX, USA).

Bai X.L., Yang X.Y., Li J.Y., Y.e.-.L.i., Jia X., Xiong Z.F., Wang Y.M, & Jin S. (2017). Cavin-1 regulates caveolae-mediated LDL transcytosis: crosstalk in an AMPK/eNOS/ NF-κB/Sp1 loop. Oncotarget, 8(61), 103985-103995.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!