Nanodrop nd 1000 machine

To determine gene expression levels, total RNA was extracted six hours after the second stimulation with LPS (100 ng/mL) using a QIAzol Lysis Reagent (#79306) purchased from Qiagen (Hilden, Germany) following the manufacturer’s instructions. During the whole procedure, an RNase Away (#7003, Molecular BioProducts, San Diego, CA, USA) solution was used to flush pipettes and other equipment to prevent any contamination with other RNases or DNAs. RNA concentration and quality were checked by using the Nanodrop ND-1000 machine (Peqlab, Erlangen, Germany). Complementary DNA (cDNA) was synthesized using a RevertAid First Strand cDNA Synthesis kit (#K1612) from Thermo Fisher Scientific (Waltham, MA, USA). Real-time qPCR reaction was performed by using a StepOnePlus^TM real-time PCR System (Applied Biosystems, Foster City, CA, USA). Primers used in the study are listed in Table 1.
GAPDH was used as the housekeeping gene. Relative gene expression was calculated using the comparative C_T (2^−∆∆C_T) method [63 (link)].

Real-time qPCR was performed 6 h after final stimulation (14 (link)). To determine gene-expression levels, total RNA was extracted using QIAzol Lysis Reagent (#79306) purchased from Qiagen (Hilden, Germany). RNA concentration and quality were checked by using a Nanodrop ND-1000 machine (Peqlab, Erlangen, Germany). cDNA was synthesized using a RevertAid First Strand cDNA Synthesis kit (#K1612) from Thermo Fisher Scientific (Waltham, MA, USA). qPCR reaction was performed by using a LightCycler 480 SYBR Green (Roche, Switzerland) and Rotor gene Q machine (Qiagen, Germany). Primers used in the study are listed in Table 1. Housekeeping genes, GAPDH and HMBS, were used for normalization. Relative gene expression was calculated by the comparative C_T ( $2_{\text{T}}^{-\Delta \Delta \text{C}}$ ) method (22 (link)).

Total RNA was extracted from microglial cells using QIAzol Lysis Reagent (#79306) purchased from Qiagen (Hilden, Germany). RNA concentration and quality were checked by using the Nanodrop ND-1000 machine (Peqlab, Erlangen, Germany). Complementary DNA (cDNA) was synthesized using RevertAid First Strand cDNA Synthesis kit (#K1612) from Thermo Fisher Scientific (Waltham, MA, USA). qPCR reaction was performed by using Realplex Mastercycler EpGradient S (Eppendorf AG, Germany). The following primer pairs were used: HIF-1α forward: CTCATCAGTTGCCACTTCC and HIF-1α reverse: TCATCTTCACTGTCTAGACCAC, MyD88 forward: TCCGGCAACTAGAACAGACAGACT and MyD88 reverse: GCGGCGACACCTTTTCTCAAT, TLR4 forward: ACCTGGCTGGTTTACACGTC and TLR4 reverse: CAGGCTGTTTGTTCCCAAAT, GAPDH forward: CATGGCCTTCCGTGTTTCCTA and GAPDH reverse: CCTGCTTCACCACCTTCTTGAT. GAPDH was used as housekeeping gene. Relative gene expression was calculated using the comparative C_T ( $2_{\text{T}}^{-\Delta \Delta \text{C}}$ ) method (24 (link)).