Sybr green premixture

GNAQ, GNA11 and BRAF amplicons were attained from UM by PCR using Sybr green premixture (Bio-Rad, Veenendaal, Netherlands). The following protocol was used for amplification of exon 5 of the GNA11 and the GNAQ genes:
94°C, 3min; (96°C, 15sec; 63°C, 15sec; 72°C, 1min) 7X; (96°C, 15sec; 61°C, 15sec; 71°C, 1min) 8X; (96°C, 15sec; 60°C, 15sec; 72°C, 1min), 36X; 72°C, 1min, end. For amplification of exon 15 of BRAF the following protocol was used:
94°C, 3min; (96°C, 15sec; 60°C, 15sec; 72°C, 30sec) 40X; 72°C, 1min, end.
The primers used in PCR consisted of:
CGCTGTGTCCTTTCAGGATGGTG, GNA11ex5FGCCCACCTAGTTGTCCGACT, GNA11ex5RCCCTAAGTTTGTAAGTAGTGCTATATTTATGTTG, GNAQex5FATGATAATCCATTGCCTGTCTAAAGAACAC, GNAQex5RAACTCTTCATAATGCTTGCTCTGATAGG, BRAFex15FGCCTCAATTCTTACCATCCACAAAATG, BRAFex15RAfter amplification, DNA clean-up was performed using the Nucleospin Extract II columns of Macherey-Nagel (Düren, Germany) following the manufacturer’s instructions. For sequencing analysis, samples were prepared by adding 10 pmol of the forward or the reverse primer to the purified DNA amplicon. Sequencing for mutations was performed at the Leiden Genomic Technology Center (LGTC) of the LUMC.

For validation of the GNAQ and GNA11 mutation status, as acquired by dPCR, Sanger sequencing was performed on all 66 UM DNA samples by PCR using a Sybr green premixture from Bio-Rad Laboratories, Inc. Primers used are summarized in S2 Table, and the following PCR protocol was used for amplification of exon 4 and exon 5 of GNAQ and GNA11 genes: 94°C, 3min; (96°C, 15sec; 63°C, 15sec; 72°C, 1min) 7x; (96°C, 15sec; 61°C, 15sec; 71°C, 1min) 8x; (96°C, 15sec; 60°C, 15sec; 72°C, 1min) 36x;72°C, 1min; till end. Following amplification DNA clean-up was performed using Nucleospin Extract II columns (Machery-Nagel, Düren, Germany) according to the manufacturer’s instruction. For Sanger sequencing analysis 10 pmol of the forward or reverse primer was added to the purified DNA amplicon. Sequencing for mutations was outsourced (Baseclear, Leiden, Netherlands). In UM samples showing no mutation in exon 5 of GNAQ or GNA11 the exon 4 mutation status of both genes was determined (method identical to exon 5), primers are summarized in S2 Table. We used Mutation Surveyor software (Softgenetics, State College, USA) to assist mutation analysis.