Direct zol rna miniprep protocol

Manufactured by Zymo Research

The Direct-zol™ RNA miniprep protocol is a laboratory technique used for the rapid and efficient extraction and purification of total RNA from various sample types. It provides a streamlined method for isolating high-quality RNA suitable for downstream applications such as real-time PCR, Northern blotting, and microarray analysis.

Automatically generated - may contain errors

Lab products found in correlation

Ssofast evagreen supermix, by Bio-Rad (1 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions) Qiashredder column, by Qiagen (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions) Ribo zero bacterial rrna removal kit, by Illumina (1 mentions) Zirconia silica bead, by Biospec (1 mentions) E coli poly a polymerase, by New England Biolabs (1 mentions) Bead beater, by Biospec (1 mentions) Turbo dnase, by Thermo Fisher Scientific (1 mentions) T4 polynucleotide kinase, by New England Biolabs (1 mentions) Affinityscript multiple temperature reverse transcriptase, by Agilent Technologies (1 mentions) Herculase 2 polymerase, by Agilent Technologies (1 mentions)

Close spelling variants of this product

Direct-zol RNA MiniPrep (611 citations) Direct-zol (62 citations) Direct-zolTM RNA MiniPrep (41 citations) Direct-zol MiniPrep (14 citations) Direct-zol protocol (3 citations)

2 protocols using direct zol rna miniprep protocol

Breast Carcinoma RNA Extraction and Real-Time PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cryosectioned breast carcinomas were dissolved in Trizol (Invitrogen) by vortexing and and manually homogenized using a VWR™ Disposable Pestle (Argos Technologies). After running through QIAshredder™ columns (Qiagen), total RNA were extracted using the Direct-zol™ RNA miniprep protocol (Zymo research) and were reversely transcribed using the High Capacity RNA-to-cDNA Kit (Applied Biosystems). Quantified real-time PCR was performed using Taqman gene expression assays (Applied Biosystems) for CEACAM6 or SsoFast™ EvaGreen^® Supermix (Bio-Rad) for CEACAM5 and EpCAM on Bio-Rad CFX manager 3.0 and thermocycler (Bio-Rad). The primers used were: CEACAM5 (forward TTTCTCCCTATGTGGTCGCTCCAG, reverse AGCAG ATTTTTATTGAACTTGTGC) that were adapted from a web-based primer bank, EpCam (forward AGTGTACTTCAGTTGGTGCACAAA, reverse AGTGTCCTTGTCTGTTCTTCTGAC), and GAPDH (forward ACCACAGTCCATGCCATCAC, reverse TTCACCACCCTGTTGCTGTA), CEACAM6-FAM (Hs03645554_m1) GAPDH-VIC (Hs02758991_g1).
Gene expression was calculated by the 2^−ΔΔCt method.

Bechmann M.B., Brydholm A.V., Codony V.L., Kim J, & Villadsen R. (2020). Heterogeneity of CEACAM5 in breast cancer. Oncotarget, 11(43), 3886-3899.

+ Open protocol

+ Expand

Bacterial RNA Isolation and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from stationary phase bacteria by first resuspending the bacteria in TRIzol and then homogenizing the bacteria with zirconia/silica beads (BioSpec Products) in a BeadBeater (BioSpec Products) for 7 one-minute cycles. Total RNA was purified from homogenized samples with the Direct-Zol RNA miniprep protocol (Zymo), DNase treated with TURBO DNase (Life Technologies) and 3’ dephosphorylated with T4 Polynucleotide Kinase (New England Biolabs). rRNA was removed with the bacterial Ribo-Zero rRNA removal kit (Illumina). RNA sequencing libraries were prepared from rRNA-depleted RNA using a derivative of the previously described CRISPR RNA sequencing method (Heidrich et al., 2015 (link)). Briefly, transcripts were poly-A tailed with E. coli Poly(A) Polymerase (New England Biolabs), ligated with 5’ RNA adapters using T4 RNA Ligase 1 (ssRNA Ligase), High Concentration (New England Biolabs), and reverse transcribed with AffinityScript Multiple Temperature Reverse Transcriptase (Agilent Technologies). cDNA was PCR amplified with barcoded primers using Herculase II polymerase (Agilent Technologies) .

Shmakov S., Abudayyeh O.O., Makarova K.S., Wolf Y.I., Gootenberg J.S., Semenova E., Minakhin L., Joung J., Konermann S., Severinov K., Zhang F, & Koonin E.V. (2015). Discovery and functional characterization of diverse Class 2 CRISPR-Cas systems. Molecular cell, 60(3), 385-397.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!