The apoptotic incidence was detected by Annexin V/propidium iodide (PI), Annexin V-APC/7-AAD and binding buffer (KeyGEN Biotech). Neuro 2A cells were treated with various treatments. Cells were then collected and re-suspended in 500μl 1xbinding buffer and then incubated for 15 minutes without light exposure. Apoptotic cells, including early apoptotic (Annexin V + /PI -) and late apoptotic/necrotic (Annexin V + /PI + ) cells, were counted using FACS (ACEA Biosciences, CA, USA).
Binding buffer
Manufactured by Keygen Biotech
Sourced in China
Binding buffer is a laboratory solution used to facilitate the binding of target molecules, such as proteins or nucleic acids, to a solid support or matrix during various purification or separation processes. It helps create the appropriate chemical environment to enable efficient binding and adsorption of the target analyte to the solid phase.
Automatically generated - may contain errors
Lab products found in correlation
Annexin 5 fitc, by Keygen Biotech (7 mentions)
Propidium iodide, by Keygen Biotech (6 mentions)
Annexin 5 fluorescein isothiocyanate, by Keygen Biotech (5 mentions)
Facscalibur flow cytometer, by BD (5 mentions)
Accuri c6, by BD (4 mentions)
Facscalibur, by BD (3 mentions)
Annexin 5 apoptosis detection kit, by Keygen Biotech (3 mentions)
Annexin 5 apc 7 aad, by Keygen Biotech (2 mentions)
Attune flow cytometer, by Thermo Fisher Scientific (2 mentions)
Annexin 5 fluorescein isothiocyanate fitc propidium iodide apoptosis detection kit, by Keygen Biotech (2 mentions)
Annexin 5 fitc pi apoptosis detection kit, by Keygen Biotech (2 mentions)
Fluorescence activated cell sorting (facs), by Agilent Technologies (2 mentions)
Annexin 5 propidium iodide, by Keygen Biotech (2 mentions)
Cellquest pro software, by BD (2 mentions)
Binding buffer, by BD (2 mentions)
Facsort flow cytometer, by BD (1 mentions)
Facs fc500, by Beckman Coulter (1 mentions)
F 7000, by Hitachi (1 mentions)
Cell cycle detection kit, by Keygen Biotech (1 mentions)
Annexin 5 apoptosis detection kit, by Thermo Fisher Scientific (1 mentions)
46 protocols using binding buffer
1
Apoptosis Quantification by Flow Cytometry
2
Annexin V-FITC/PI Apoptosis Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trypsin without EDTA (ethylenediaminetetraacetic acid) was used to collect HK-2 cells. Then the cells were washed 3 times with phosphate-buffered saline (PBS). 200 μL Binding buffer (KeyGen, Shanghai, China) was added to each group of cells and mixed gently. Then 5 μL of Annexin V-FITc (KeyGen, Shanghai, China) and PI (KeyGen, Shanghai, China) were added to stain the cells. Finally, the mixed solution was incubated at room temperature in the dark for 15 minutes, and then the apoptosis rate of HK-2 cells was analyzed by flow cytometry.
3
Apoptosis Analysis of tFNAs-miR-214-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We divided the cells into three groups. The treatment group was treated with 150 nmol/L tFNAs‐miR‐214‐3p in 0% FBS DMEM/F12, the control group was treated with 150 nmol/L tFNAs in 0% FBS DMEM/F12, and the blank group was treated with the same volume of TM buffer to avoid the error caused by diluting the medium. After 72 hours, cells were collected by trypsin solution without enediaminetetraacetic acid (Solarbio) and washed with PBS twice. To each group, we added 500 μL of binding buffer (KeyGen Biotech) followed by 5 μL of Annexin V‐FITC and 5 μL of propidium iodide (PI; KeyGen Biotech) that were incubated for 15 minutes and 5 minutes, respectively. Ultimately, the compounds were measured by a flow cytometer (FC500 Beckman).
4
Cell Cycle and Apoptosis Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfected/transduced U251 or U87 cells (1×106 cells) were harvested using trypsin digestion. For cell cycle analysis, cells were stained with 5 µl propidium iodide (PI; 100 µg/ml) with 1 U/ml ribonuclease (Abcam) for 30 min at room temperature, according to the manufacturer’s protocols. For apoptosis analysis, cells were resuspended in 100 µl binding buffer (Nanjing KeyGen Biotech Co., Ltd.) containing 5 µl PI (100 µg/ml) with 1 U/ml ribonuclease in the dark for 30 min at room temperature, and then incubated with additional 5 µl of Annexin V-FITC for another 15 min in the dark at room temperature, according to the manufacturer’s protocols. Cells were subsequently analyzed by FACS using an Attune flow cytometer (Thermo Fisher Scientific, Inc.) with software FlowJo 1.1.0 (Tree Star, Inc.) for the determination of apoptotic rates, which is presented as a combination of early and late stage apoptosis.
5
Cytotoxicity and Apoptosis Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells (1×106 cell/ml) were incubated with medium containing MTT (5 mg/ml) for 4 h and dissolved with 150 µl DMSO. The medium was removed and dissolved with 150 µl DMSO for 15 min at room temperature. The absorbance was measured at 490 nm using a microplate reader.
To analyze apoptosis, the cells were washed twice with ice-cold PBS and resuspended in 500 µl binding buffer (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China). Subsequently, 5 µl annexin V-fluorescein isothiocyanate and 5 µl propidium iodide (both Nanjing KeyGen Biotech Co., Ltd.) were added and the cells were incubated for 15 min at room temperature in the dark. Apoptosis was analyzed using a FACSort flow cytometer and quantified using BD CellQuest™ Pro software (BD Biosciences, Franklin Lakes, NJ, USA).
To analyze apoptosis, the cells were washed twice with ice-cold PBS and resuspended in 500 µl binding buffer (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China). Subsequently, 5 µl annexin V-fluorescein isothiocyanate and 5 µl propidium iodide (both Nanjing KeyGen Biotech Co., Ltd.) were added and the cells were incubated for 15 min at room temperature in the dark. Apoptosis was analyzed using a FACSort flow cytometer and quantified using BD CellQuest™ Pro software (BD Biosciences, Franklin Lakes, NJ, USA).
6
Knockdown of HOXA5 in Cell Cycle and Apoptosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Target sequence (5'-3') HOXA5 shRNA-1 GGACTACCAGTTGCATAATTA HOXA5 shRNA-2 GCTTTCTGTTCATCTCTTTGT HOXA5 shRNA-3 GCAGAAGGAGGATTGAAATAG HOXA5, homeobox A5; shRNA, short hairpin RNA.
measured at 450 nm using an ELISA reader (F-7000; Hitachi High-Technologies Corporation, Tokyo, Japan).
Cell cycle analysis. Cell cycle analysis was conducted using a Cell Cycle Detection kit (Nanjing KeyGEN Biotech Co., Ltd.) following the manufacturer's instructions 48 h post-transfection. Briefly, the cells were collected and fixed with 70% cold ethanol at 4˚C overnight. The DNA was stained with RNase and propidium iodide (PI) for 30 min at room temperature, and then analyzed by flow cytometry (FACS FC500; Beckman Coulter).
Cell apoptosis analysis. A total of 1x10 5 cells were collected 48 h post-transfection, washed twice with PBS, and then resuspended in binding buffer (Nanjing KeyGEN Biotech Co., Ltd.). Cell suspension was stained with Annexin V-fluorescein isothiocyanate and PI (Nanjing KeyGEN Biotech Co., Ltd.) for 5-15 min at room temperature, and analyzed by flow cytometry.
Statistical analysis. The data are expressed as the mean ± standard deviation. The results were evaluated by one-way analysis of variance using SPSS 16.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant result.
measured at 450 nm using an ELISA reader (F-7000; Hitachi High-Technologies Corporation, Tokyo, Japan).
Cell cycle analysis. Cell cycle analysis was conducted using a Cell Cycle Detection kit (Nanjing KeyGEN Biotech Co., Ltd.) following the manufacturer's instructions 48 h post-transfection. Briefly, the cells were collected and fixed with 70% cold ethanol at 4˚C overnight. The DNA was stained with RNase and propidium iodide (PI) for 30 min at room temperature, and then analyzed by flow cytometry (FACS FC500; Beckman Coulter).
Cell apoptosis analysis. A total of 1x10 5 cells were collected 48 h post-transfection, washed twice with PBS, and then resuspended in binding buffer (Nanjing KeyGEN Biotech Co., Ltd.). Cell suspension was stained with Annexin V-fluorescein isothiocyanate and PI (Nanjing KeyGEN Biotech Co., Ltd.) for 5-15 min at room temperature, and analyzed by flow cytometry.
Statistical analysis. The data are expressed as the mean ± standard deviation. The results were evaluated by one-way analysis of variance using SPSS 16.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant result.
7
Annexin V Apoptosis Assay for Glioma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Annexin V apoptosis detection kit (Life technologies, Grand Island, NY) was employed for flow cytometry analysis. 2 × 105 fresh glioma cells were reaped and put on ice for 1 h. Then, the resuspended cells in 100 µl binding buffer (Nanjing KeyGen Biotech Co., Ltd.) were processed with 5 µl PI (100 µg/ml) and 1 U/ml ribonuclease in a dark environment at room temperature for half an hour. Afterwards, cells were cultivated with 5 µl of Annexin V-FITC for additional 15 minutes, based on the manufacturer’s instructions. Subsequently, FACSCalibur (BD Biosciences, San Jose, CA) was utilized to analyze cells with an Attune flow cytometer (Thermo Fisher Scientific, Inc.). Software FlowJo 1.1.0 (Tree Star, Inc.) was used to determine the apoptosis rate.
8
Assessing Apoptosis in Gastric Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell apoptosis was assessed using a flow cytometer. Certain gastric cancer cells were treated with 25 µM LY294002 (Beyotime Institute of Biotechnology). Cells (1×105) were treated with 15 µg/ml 5-FU (Sigma-Aldrich; Merck Millipore) for 24 h at 37°C. Following treatment with 5-FU, cells were trypsinized (0.2%; Thermo Fisher Scientific, Inc.) and centrifuged at 309 × g for 5 min at 4°C, prior to the addition of 500 µl binding buffer (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China). Cells were subsequently cultured with 5 µl Annexin V-fluorescein isothiocyanate (FITC) and 5 µl propidium iodide (PI) (both Nanjing KeyGen Biotech Co., Ltd.) for 15 min in the dark at RT. Apoptotic cells were identified using flow cytometry and BD Accuri C6 software (BD Biosciences, San Jose, CA, USA).
9
Cell Apoptosis Detection by Flow Cytometry
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (Neuro2a cells and HUVECs) were washed twice with PBS before the experiments. The cells were collected via centrifugation at 1000 rpm for 5 min and then stained with Annexin V/propidium iodide (PI), Annexin V-APC/7-AAD and binding buffer (KeyGEN Biotech) at room temperature for 15 min. After mixing, the samples were analyzed using a flow cytometer. The data was analyzed by soft of BD Accuri C6.
10
Annexin V Flow Cytometry for Apoptosis Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flow cytometry analysis was performed using the Annexin V FITC apoptosis detection kit (KeyGen Biotech, Ltd., Nanjing, China) as described previously [42 (link)]. Briefly, cells (1 × 105) were incubated with cisplatin (33.33 μM), GRN A (14.53 μM) and the combination of the two drugs. After treatment for 24 h, cells were harvested by a centrifugation at 1000 g for 5 min, washed with phosphate-buffered saline (PBS) twice, and resuspended in 500 μL binding buffer (KeyGen Biotech, Ltd., Nanjing, China). Then, Annexin V FITC (5 μL) and PI (5 μL) were added. Cells were gently vortexed, incubated for 10 min at room temperature in the dark, and immediately analyzed by the FACS flow cytometry system (Bection-Dickinson, San Jose, CA, USA). Data are expressed as means ± SD; per group for at least 3 independent experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!