Purelink total rna purification system

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PureLink Total RNA Purification System is a kit designed for the isolation and purification of total RNA from a variety of sample types. It utilizes a silica-based membrane technology to capture and purify RNA, enabling efficient recovery of high-quality RNA for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

8 protocols using purelink total rna purification system

Multiplex RT-PCR analysis of GLCE expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Multiplex RT-PCR analysis of GLCE expression was performed as previously described (24 (link)). Total RNA was extracted using the PureLink Total RNA Purification System (Invitrogen), cDNA was synthesized using a First Strand cDNA Synthesis kit (Fermentas). The PCR primers used were: GLCE-F, 5’-AAGGGAGACGAGAGGGGAACGAA-3’; GLCE-R, 5’-GCCACCTTTCTCATCCTGGTTC-3’; GAPDH-F, 5’-GGGCGCCTGGTCACAA-3’; GAPDH-R, 5’-AACATGGGGGCAT CAGCAGA-3’.

Suhovskih A.V., Tsidulko A.Y., Kutsenko O.S., Kovner A.V., Aidagulova S.V., Ernberg I, & Grigorieva E.V. (2014). Transcriptional Activity of Heparan Sulfate Biosynthetic Machinery is Specifically Impaired in Benign Prostate Hyperplasia and Prostate Cancer. Frontiers in Oncology, 4, 79.

+ Open protocol

+ Expand

RNA Isolation and Quantitative RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cells by using PureLink Total RNA Purification System (Invitrogen, Carlsbad, CA) and following manufacturer recommendations. RNA yield was quantified by measuring the optical density at 260 and 280 nm using an Eppendorf BioPhotometer. 1 µg RNA was reverse transcribed in a 20 µL reaction using oligo(dT)20 and SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA) following manufacturer recommendations. PCR was performed using 5 µL SYBR GreenER qPCR SuperMix (Invitrogen, Carlsbad, CA), 2 µL cDNA, 1 µL gene specific primer mix (QuantiTect primer Assays, QIAGEN, Valencia, CA) and 2 µL water for a total reaction volume of 10 µL. Quantification of gene expression was performed using 7900HT Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA). The thermal profile of the reaction was: 50°C for 2 min, 95°C for 10 min and 40 cycles of 95°C for 15 seconds followed by 60°C for 1 min. All samples were run in triplicates. Amplification of the sequence of interest was compared with a reference probe (mouse β-Actin, QT01136772) and normalized against a standard curve of cell line mRNA. The 7900HT Fast Real-Time PCR System Software was used for data analyses (Applied Biosystems, Carlsbad, CA).

Sun L., Hua Y., Vergarajauregui S., Diab H.I, & Puertollano R. (2015). Novel role of TRPML2 in the regulation of the innate immune response. Journal of immunology (Baltimore, Md. : 1950), 195(10), 4922-4932.

+ Open protocol

+ Expand

Fascin cDNA Cloning from HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The fascin total RNA samples were extracted
from HeLa cells using a PureLink total RNA purification system (Invitrogen)
and quantitatively analyzed using a Nanodrop spectrophotometer (Thermo
Scientific). The fascin cDNA was generated using a Superscript III
one-step RT-PCR system (Invitrogen) with the following primers: fascin1-F
(sense) 5′-GAA TTC ATG ACC GCC AAC GGC ACA GC-3′ and
fascin1-R (antisense) 5′-AAG CTT CTA GTA CTC CCA GAG CGA GGC-3′.
The RT-PCR reaction was carried out as follows: step 1, 45 °C
for 30 min and 94 °C for 2 min; step 2, for 35 cycles 94 °C
for 15 s, 51 °C for 30 s, and 72 °C for 1 min and 30 s;
step 3, 72 °C for 5 min and hold at 4 °C. Human fascin cDNA
(1.5 kilobases [kb]) samples were then cloned into a pcDNA 3.1 vector
(Invitrogen).

Zheng S., Zhong Q., Xi Y., Mottamal M., Zhang Q., Schroeder R.L., Sridhar J., He L., McFerrin H, & Wang G. (2014). Modification and Biological Evaluation of Thiazole Derivatives as Novel Inhibitors of Metastatic Cancer Cell Migration and Invasion. Journal of Medicinal Chemistry, 57(15), 6653-6667.

+ Open protocol

+ Expand

Total RNA Extraction and RT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the cells using the PureLink Total RNA Purification System (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. cDNA was synthesized from 1 to 2 μg of total RNA using a First Strand cDNA Synthesis kit (Fermentas, Hanover, MD, USA) and 1/10th of the product was subjected to PCR analysis.
The following conditions were used for RT-PCR: 95°C for 10 min, 95°C for 15 s, 55–64°C for 15 s, and 72°C for 1 min, with a final elongation step at 72°C for 10 min using a Tercik PCR machine (DNA-Technology, Russia). The total reaction volume was 20 μl. The amplified products were separated on 1.2% agarose gels. The gels were scanned using the “DNA Analyzer” system (Moscow, Russia) and genes expression levels were estimated from the intensity of the amplified DNA fragment normalized against the intensity of GAPDH.
The PCR primers and conditions are listed in Table 1.

+ Open protocol

+ Expand

Differential Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Based on the expression values as FPKM, DEGs were identified between the two samples (N-S and C-S) after transformation, normalization, and fold change (fc) comparisons. Quantitative real-time PCR (qRT-PCR) was conducted using the SYBR Green method in a StepOnePlus Real-Time PCR System (Applied Biosystems, Walthman, MA, USA). Total RNA was extracted from slug–control and slug–nematode treatments using the Purelink Total RNA Purification System (Thermo Fisher Scientific). cDNA templates were synthesized from 1 μg of total RNA using the Invitrogen SuperScript III First-Strand Synthesis SuperMix according to the manufacturer’s instructions. The qRT-PCR reaction mixtures were prepared in 20 μL with 1× PowerUp SYBR Green Master Mix (Thermo Fisher Scientific), 0.25 μM primer pairs, and cDNA template. The qRT-PCR reaction conditions were performed at 95 °C for 10 min; 40 cycles of 95 °C for 15 s and 60 °C for 1 min; followed by a melting curve analysis over the range of 60–95 °C with 0.3 °C/min increments, with specific primers listed in Table S1. The Rpt6 gene was selected as a reference gene (Table S1). Three biological samples for each group were replicated.

Hafeez M., Mc Donnell R., Colton A., Howe D., Denver D., Martin R.C, & Choi M.Y. (2024). Immune-Related Gene Profiles and Differential Expression in the Grey Garden Slug Deroceras reticulatum Infected with the Parasitic Nematode Phasmarhabditis hermaphrodita. Insects, 15(5), 311.

+ Open protocol

+ Expand

RNA Isolation and Quality Validation for Nematode-Infected Slugs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from the whole body of a single adult slug infected with nematodes and a noninfected control slug using the Purelink Total RNA Purification System (Thermo Fisher Scientific, Waltham, MA, USA). RNA was treated with TURBO^TM DNase (Thermo Fisher Scientific) for 30 min at 37 °C to eliminate genomic DNA, according to the manufacturer’s instructions (Figure 1). RNA was further purified by using the RNeasy MinElute Cleanup Kit (Qiagen, Germantown, MD, USA) and eluted in 20 μL of RNA storage solution. The quantity of the RNA was assessed using a NanoDrop Spectrophotometer ND-2000 (Thermo Fisher Scientific). The six RNA samples (N-S and C-S per 3 replicates) were then sent to Psomagen (Rockville, MD, USA) for RNA quality analysis using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). To maximize RNA quality, only samples with an RNA integrity number (RIN) value of 7 or greater were used for the next step.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with the PureLink total RNA purification system using the on‐column DNase protocol (Life Technologies Inc) according to manufacturer's instructions. RNA concentration and purity were determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific) in duplicate. For quantitative reverse transcriptase PCR, 500 ng of total RNA was reverse transcribed using the iScript cNDA synthesis kit (Bio‐Rad). A reaction mixture of 12.5 ng of reverse‐transcribed cDNA, DNMT1 forward primer (TGCCAGCTGAGCGTGGTGGT), DNMT1 reverse primer (GCATGCGGGCAGCCACCAAT), and FastStart SYBR Green (Roche Applied Sciences) underwent quantitative reverse transcriptase PCR on a CFX96 Real‐Time Detection System (Bio‐Rad). Expression was normalized to β2‐microglobulin (forward 5′‐AGCATTCGGGCCGAGATGTCT‐3′, reverse 5′‐CTGCTGGATGACGTGAGTAAACCT‐3′), which is endogenously expressed and is not altered by many stimuli including shear stress.36 Normalized expression was quantified using the comparative 2^ΔΔCt method.

Heuslein J.L., Gorick C.M., Song J, & Price R.J. (2017). DNA Methyltransferase 1–Dependent DNA Hypermethylation Constrains Arteriogenesis by Augmenting Shear Stress Set Point. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 6(12), e007673.

+ Open protocol

+ Expand

Klotho Gene Expression in Mouse Brain

Check if the same lab product or an alternative is used in the 5 most similar protocols

Klotho gene expression in the various brain tissues was studied using both conventional RT-PCR and the RT² qPCR assay system (SABiosciences, CA) in accordance with the manufacturer's recommendations on the Eppendorf Realplex 4S platform. Briefly, brain tissues from different regions of wild type C57BL/6 adult mouse were collected under RNase free conditions and total RNA was isolated using TRIZOL RNA isolation reagent (Life Technologies) and purified using PureLink Total RNA Purification System (Life Technologies). First-strand synthesis was oligo-d(T)-primed and Klotho and GAPDH were then amplified using specific primers. In the case of the qPCR, 1 μg of total RNA was treated with DNase and first strand cDNA synthesis was achieved using RT² First Strand kit (SABiosciences). Relative mRNA expression was analyzed using actin or cyclophilin A primers as internal controls.

Brobey R.K., German D., Sonsalla P.K., Gurnani P., Pastor J., Hsieh C.C., Papaconstantinou J., Foster P.P., Kuro-o M, & Rosenblatt K.P. (2015). Klotho Protects Dopaminergic Neuron Oxidant-Induced Degeneration by Modulating ASK1 and p38 MAPK Signaling Pathways. PLoS ONE, 10(10), e0139914.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!