DNA was extracted from CEC-like cells and corneal endothelial cells of EXP1, EXP2, MON, and HCEC groups using a DNA extraction kit (Tiangen) according to the manufacturer’s protocol. Human and monkey specific Cytb gene fragments were amplified by polymerase chain reaction (PCR) with the Ultra HiFidelity PCR Kit (Tiangen) according to the manufacturer’s protocol. Primers designed by BioSune Biotech (Shanghai, China) are listed in Table 1 . Agarose gel electrophoresis was carried out with the PCR product according to the standard method. Amplified DNA was purified using the TIANgel Midi Purification Kit (Tiangen). The sequencing of DNA was performed in BioSune Biotech (Shanghai, China) with the ABI3730XL sequenator. Data was analyzed with Chramas.
Ultra hifidelity pcr kit
Manufactured by Tiangen Biotech
Sourced in China
The Ultra HiFidelity PCR Kit is a laboratory equipment product designed for performing high-fidelity polymerase chain reaction (PCR) amplification of DNA samples. The kit includes the necessary reagents and components required for conducting PCR experiments with enhanced accuracy and reliability.
Automatically generated - may contain errors
Lab products found in correlation
Tiangel midi purification kit, by Tiangen Biotech (1 mentions)
Dna extraction kit, by Tiangen Biotech (1 mentions)
Monarch dna gel extraction kit, by New England Biolabs (1 mentions)
Primer premier 5, by Premier Biosoft (1 mentions)
Peasy blunt vector, by Transgene (1 mentions)
Abi prism 3730 automatic sequencer, by Thermo Fisher Scientific (1 mentions)
Dual glo luciferase system kit, by Promega (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Megaclear transcription clean up kit, by Thermo Fisher Scientific (1 mentions)
Megashortscript t7 transcription kit, by Thermo Fisher Scientific (1 mentions)
5 protocols using ultra hifidelity pcr kit
1
Extraction and Sequencing of Cytb Gene
2
Cloning and Sequencing Lepidopteran Developmental Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequences (CDSs) of PxMettl3, PxMettl14, PxWTAP, PxSpenito, PxVirlizer, PxFlacc, PxHakai, and PxJHE genes in P. xylostella were obtained from the GenBank database (https://www.ncbi.nlm.nih.gov/ ) with the following accession numbers (PxMettl3, XM_048628151; PxMettl14, XM_011552978; PxWTAP, XM_011549585; PxSpenito, XM_011558003; PxVirlizer, XM_011558189; PxFlacc, XM_038120833; PxHakai, XM_011553442; PxJHE, XM_011558701). The CDS sequences of these genes were in silico corrected using the P. xylostella transcriptome database derived in this work. Gene‐specific primers for cloning the full‐length cDNA sequences of these genes were designed using the Primer Premier 5.0 software (Premier Biosoft). Ultra HiFidelity PCR Kit (TIANGEN) was used for PCR amplification. The PCR products were purified using the Monarch DNA Gel Extraction Kit (New England Biolabs), and the purified products were subcloned into the pEASY‐Blunt vector (TransGen) and sequenced. The full‐length cDNA sequences of PxMettl3, PxMettl14, PxWTAP, PxSpenito, PxVirlizer, PxFlacc, PxHakai, and PxJHE genes had been submitted to the GenBank database (accession nos. OQ291273‐OQ291280, respectively).
3
Detecting Candidate Mutations via PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR primers for the candidate mutation were designed based on the reference sequence from GenBank (NM_004006.2) and synthesized by Sangon Biotech. The primers’ sequences for NM_004006.2:c.6963del were F: 5’–TGCAGTTGGCTATGCCTTTG–3’; R: 5’–CAAAAAGTTCCCTACCTTACG–3’. The primers’ sequences for NM_004006.2:c.3637A>T were F: 5’–AGAGCCACTGGTAGTTGGTG–3’; R: 5’– ACTGGGATGTTGTGAGAAAGAA–3’. The Ultra HiFidelity PCR Kit (TIANGEN) was used on an ABI 9700 thermal cycler (Applied Biosystems). PCR conditions were as follows: 94 °C 3 minutes; 94 °C 30 seconds, 55 °C 30 seconds, and 72 °C 60 seconds for 30 cycles; and 72 °C 5 minutes. Sanger sequencing was carried out on an ABI PRISM 3730 automatic sequencer (Applied Biosystems). The sequence chromatograms were compared and visualized by the TBtools software.14 (link)
4
Investigating MEG3-miR-29c Regulatory Axis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wide type (WT)-MEG3 containing binding sites were amplified by PCR using Ultra HiFidelity PCR Kit (TIANGEN, Beijing, China), and mutation type (MUT)-MEG3 was synthesized by Sangon (Shanghai, China). The obtained MUT-MEG3 and WT-MEG3 sequences were cloned into pmirGLO vectors. The vectors carried with WT-MEG3 were co-transfected with miR-29 c mimics, miR-29 c inhibitors, or miR-NC into MRC-5 cells via lipofectamine 3000 ((Life Technologies, Carlsbad, USA). The co-transfection procedures of MUT-MEG3 were consistent with that of the WT-MEG3 group. Luciferase activities were surveyed 48 hours after transfection utilizing the Dual-Glo luciferase system kit (Promega, Madison, USA) [20 (link)].
5
In vitro sgRNA Synthesis and Target DNA Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 98-nt sgRNA was in vitro transcribed and purified using the MEGAshortscript T7 Transcription Kit and the MEGAclear Transcription Clean-Up Kit from Thermo Fisher Scientific (China) Co., Ltd., Pudong New Area, Shanghai, China. A 920-bp target DNA contained PAM (TGG) was amplified by the Ultra HiFidelity PCR Kit (TIANGEN, Sichuan, China) at the following conditions (94°C 30 s, 55°C 30 s, 72°C 1.5 min, 30 cycles), and was purified using the AxyPrepTM DNA Gel Extraction Kit (Axygen Biotechnology, Taizhou, China). The purified sgRNA and DNA were resuspended using the desired solution and volume, and stored at −80°C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!