Fuw m2rtta

The lentiviral expression vector pLV-hTERT-IRES-hygro [19 (link)] and FUW-M2rtTA [20 (link)] were obtained from Addgene (#85140 and #20342, respectively). The lentiviral vector TetO-HHFG (Additional file 1: Fig. S1A) was described in detail previously ([9 (link)]. Lentivirus was generated in 293 T cells by cotransfection of pHIV vector with pPAX2 and pMD2.G in 10:7.5:5 ratio. Lentivirus was collected and concentrated using Lenti-X concentrator following manufacturer´s instructions (Takara). We routinely performed two analysis to confirm lentivirus production and concentration. First, we used Lenti-X GoStrix (Takara) to confirm a titer above 5 × 10⁵ infectious units per ml after concentration. Second, we always produced in parallel a control lentiviral vector expressing GFP (pHIV-eGFP-FOXA3) and infect human fibroblasts. GFP-positivity should be higher than 75% by flow cytometer.

Full-length cDNA encoding WT human KCNQ2 splice isoform 4 cDNA (K_V7.2; GenBank accession NM_172108) was engineered in the mammalian expression vector pIRES2_EGFP or a modified vector where EGFP was substituted by CyOFP1. Site-directed mutagenesis of KCNQ2 was performed using QuikChange II XL (Agilent technologies, Santa Clara, CA, USA; mutagenic primer sequences: 5’: TCCCAAATTAAGAGCCTGCAGTCCAGAGTGGAC, 3’: AGGCTCTTAATTTGGGACAGCATGTCCAGGTGGC) to insert the R581Q (R550Q in isoform 4) patient mutation into the wildtype construct. KCNQ3 (K_V7.3; GenBank accession NM_004519) was cloned into pcDNA5/FRT for use in generating the KCNQ3-stable CHO-K1 cells.
TetO-Ngn2-puro (Addgene plasmid #52047) and TetO-FUW-EGFP (Addgene plasmid #30130) plasmids were gifts from Marius Wernig (Vierbuchen et al., 2010 (link); Zhang et al., 2013 (link)). FUW-M2rtTA (Addgene plasmid # 20342) was a gift from Rudolf Jaenisch (Hockemeyer et al., 2008 (link)). Lentiviruses were generated in HEK293T cells using the second-generation packaging vectors, psPAX2 and pMD2.G, as described previously (Zufferey et al., 1998 (link)) by the Northwestern University DNA/RNA Delivery Core.

Doxcyclin (Dox) and Jak inhibitor (Jaki) were purchased from Merck Millipore (Billierica, MA, USA). CHIR99021 and PD0325901 were purchased from SelleckChem (Houston, TX, USA). The LIF neutralizing antibody (LIFAb) was from R&D Systems. The retro- and lenti-viral vectors including pMXs-Nanog, and FUW- M2rtTA, and the viral packaging plasmids PUMVC, psPAX2 and pCMV-VSV-G (Stewart et al., 1992 (link)) were all obtained from Addgene (Cambridge, MA, USA). FUW-TetO-Esrrb and pMXs-Stat3C were described previously (Tang et al., 2012 (link), 2014 (link)). Nr5a2 cDNA was PCR amplified using primers (forward primer: 5′-AGTTAATTAAGGATCCATGTCTTCTAATTCAGATACTGGGG-3′ and reverse primer: 5′-ACTGTGCTGGCGGCCGCTTATGCTCTTTTGGCATGCAAC-3′) and cloned into linearized pMXs vectors (Cell Biolabs, San Diego, CA, USA) using the In-Fusion kit (Clontech Inc., Mountain View, CA, USA). Lenti- and retro-viruses were prepared with 293T cells according to the protocol from Addgene and filtered with 0.8 μm filters.

The full-length Dnmt3a Isoform 1 or its catalytic domain (the last 301 amino acids) were fused to P2A-GFP, followed by subcloning into the FUW backbone (Addgene #20723). DKO^zero cells were transduced with FUW-M2rtTA (Addgene #20342) and FUW–Dnmt3a–GFP or FUW–cat3a–GFP, respectively and treated with doxycycline for about two weeks to allow GFP based FACS and isolation of individual GFP-positive colonies. For the generation of the inducible dCas9-cat3a wild-type line, V6.5 wild-type ES cells were transduced with FUW-M2rtTA and FUW–dCas9–cat3a, selected and induced as described above. Each cell line was induced with doxycycline for two passages (7 days) prior to DNA extraction and bisulfite sequencing. For the WT^{dCas9–cat3a} line, a non-induced (no doxycycline) sample was also collected for comparison.

Patient-derived αS triplication and corrected lines (one patient line and one corrected line) were obtained through EBISC and thanks to the Kunath Lab of the University of Edinburgh^{95 (link),96 (link)}. The corresponding neurogenin-expressing lines were made with the assistance of the BWH iPSC NeuroHub. Lines were maintained as feeder-free cells in defined, serum-free media (mTeSR, Stem Cell Technologies). To generate NGN2-inducible iPSC lines, virus was produced as described previously^{97 (link)} with FUW-TetO-Ngn2-P2A-Puromycin (Addgene plasmid #52047) and FUW-M2rtTA (Addgene plasmid #20342). The iPSC line was transduced with each virus at an MOI of 30 and expanded as feeder-free cells in mTeSR. Neural induction was achieved with minor modifications to previous protocols^{98 (link)} and as per the method outlined in ref. ^{23 (link)}.